UNIVERSIDADE FEDERAL DE PELOTAS
Programa de Pós-Graduação em Biotecnologia
TESE
Nanobiotecnologia aplicada à transgênese animal
Vinicius Farias Campos
Pelotas, 2011.
VINICIUS FARIAS CAMPOS
Nanobiotecnologia aplicada à transgênese animal
Tese apresentada ao Programa de
Pós-Graduação em Biotecnologia da
Universidade Federal de Pelotas, como requisito parcial à obtenção do título de
Doutor em Ciências (área do
conhecimento: Biotecnologia).
Orientador: Prof. Tiago Collares, Dr.
Co-orientadores: Profa. Fabiana Kömmling Seixas, Dra.
Prof. João Carlos Deschamps, PhD.
Pelotas, 2011.
Dados de catalogação na fonte:
Maria Beatriz Vaghetti Vieira – CRB 10/1032 Biblioteca de Ciência & Tecnologia - UFPel
C198n Campos, Vinicius Farias
Nanobiotecnologia aplicada à transgênese animal / Vinicius Farias Campos. – 75f. : tab. – Tese (Doutorado). Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas. Centro de Desenvolvimento Tecnológico, 2011. – Orientador Tiago Collares; co-orientador Fabiana Kömmling Seixas, João Carlos Deschamps.
1.Biotecnologia. 2.SMGT. 3.Nanopolímero catiônico. 4.Bovinos. 5.Nanotubos. 6.Transferência gênica. 7.Sêmen. 8.Nanobiotecnologia. I.Collares, Tiago. II.Seixas, Fabiana Kömmling. III.Deschamps, João Carlos. IV.Título.
Banca examinadora:
Prof. Dr. Tiago Collares, Universidade Federal de Pelotas
Prof. Dr. João Carlos Deschamps, Universidade Federal de Pelotas
Profª. Dra. Fabiana Kömmling Seixas, Universidade Federal de Pelotas
AGRADECIMENTOS
Aos meus pais Noli e Clair pelo carinho, por toda a sua dedicação na minha formação, pela força e incentivo nas horas mais difíceis, apesar da nossa grande distância e saudades.
Ao meu Irmão, minha cunhada e meus sobrinhos pelo carinho e alegria despendida.
À minha esposa Heren, pelo companheirismo e incentivo.
Ao meu orientador e meu grande amigo Prof. Tiago Collares por sua dedicação na minha formação, paciência, sinceridade e pelos ensinamentos.
Ao meu co-orientador e amigo Prof. Deschamps, por ter acreditado em mim e pelos seus ensinamentos.
À minha co-orientadora e amiga Profa. Fabiana, por toda sua dedicação em minha formação e ensinamentos.
Aos meus amigos e parceiros nos experimentos da tese Priscila, Eliza e Gabriel.
Aos colegas do grupo de pesquisa em Oncologia Celular e Molecular, Helena, Fernanda Nedel, Felipe, Virgínia, Samuel, Fernando, Fernanda Rodrigues, Eduarda, Ruan, Ludmila, Marrí, Karine, Cristian, Stéphanie, Suélen, Carol, Emily, Cris e Vanessa pela amizade e colaboração no dia a dia.
Aos amigos e colegas do Lab. 10, Leonardo, Marta, Cláudia e Thais, por toda força quando necessário e pelos momentos agradáveis.
Aos professores do Programa de Pós-Graduação em Biotecnologia pelos ensinamentos.
Aos amigos e colegas do Centro de Biotecnologia pelo auxílio nas demais atividades e convivência agradável.
A todos que colaboraram de alguma forma para a execução deste trabalho. À Universidade Federal de Pelotas e ao Programa de Pós-Graduação em Biotecnologia pela oportunidade de realizar um qualificado curso de doutorado.
A CAPES pela bolsa de estudos. A todos muito OBRIGADO!!!
I get by with a little help from my friends I get high with a little help from my friends Gonna try with a little help from my friends
RESUMO
CAMPOS, Vinicius Farias. Nanobiotecnologia aplicada à transgênese animal. 2011. 75f. Tese (Doutorado) – Programa de Pós-Graduação em Biotecnologia, Universidade Federal de Pelotas, Pelotas.
A nanobiotecnologia tem proporcionado novos avanços científicos e tecnológicos em diversas áreas do conhecimento tornando-se assim área de pesquisa prioritária em países desenvolvidos e em desenvolvimento. A transferência gênica mediada por espermatozóides (SMGT) poderá se tornar a técnica mais simples, eficiente e com melhor custo-benefício para a geração de animais transgênicos. O desenvolvimento de nanocompósitos capazes de carrear o DNA exógeno para o interior de células com maior eficiência permite que técnicas como a SMGT sejam aperfeiçoadas. A NanoSMGT é uma técnica utilizada para a geração de animais transgênicos onde a nanotecnologia é utilizada para incrementar a habilidade dos espermatozóides em capurar o DNA exógeno. O objetivo do presente trabalho foi de verificar se nanopolímero catiônico ou nanotubos de haloisita são capazes de transfectar o DNA exógeno para o interior de espermatozóides bovinos sexados e não sexados e em seguida verificar se estes espermatozóides transfectados são capazes de gerar embriões bovinos transgênicos. Utilizando PCR em tempo real, verificou-se que o nanopolímero catiônico é capaz de introduzir o DNA exógeno em espermatozóides bovinos sexados e não sexados sem danos para a motilidade e viabilidade espermática. Também foi demonstrado pela primeira vez que o nanopolímero catiônico ou os nanotubos de haloisita são capazes de incrementar tanto a transfecção de DNA em espermatozóides como a transmissão do transgene para embriões bovinos produzidos in vitro. Estes resultados demonstram que a NanoSMGT pode ser uma técnica viável para a produção de embriões bovinos transgênicos.
Palavras-chave: SMGT, bovinos, transfecção, nanobiotecnologia, nanopolímero catiônico, nanotubos.
ABSTRACT
CAMPOS, Vinicius Farias. Nanobiotecnologia aplicada à transgênese animal. 2011. 75f. Tese (Doutorado) – Programa de Pós-Graduação em Biotecnologia, Universidade Federal de Pelotas, Pelotas.
Nanobiotechnology has provided new scientific and technological knowledge in distinct areas making it a priority area of research in developed and developing countries. The sperm-mediated gene transfer (SMGT) technique may become more simple, efficient and cost-effective technique for the generation of transgenic animals. The development of nanocomposites able to carry foreign DNA into the nucleus of cells with greater efficiency allows techniques such as SMGT be improved. The NanoSMGT is a technique used to generate transgenic animals in which nanotechnology is used to enhance the ability of sperm to capture exogenous DNA. The objective of this study was to determine whether cationic nanopolymer or halloysite clay nanotubes are able to transfect the exogenous DNA to unsorted and sex-sorted bovine sperm then evaluate whether these sperm are able to transmit transgene to in vitro fertilized bovine embryos. Using real-time PCR, we found that the cationic nanopolymer is capable of introducing exogenous DNA into unsorted and sex-sorted bovine sperm without negative effects to sperm motility and viability. Was also demonstrated for the first time that cationic nanopolymer or halloysite clay nanotubes are able to increase both the sperm DNA transfection of as the transmission of the transgene to bovine embryos produced in vitro. These results demonstrate that NanoSMGT can be a viable technique for producing transgenic bovine embryos.
Keywords: SMGT, cattle, transfection, nanobiotechnology, cationic nanopolymer, nanotubes.
LISTA DE ABREVIATURAS E SIGLAS
ANOVA – Análise de variância BSA – Albumina sérica bovina CMV – Citomegalovírus
COC – Complexo cumulus-oócito DMSO – Dimetilsulfóxido
DNA – Ácido desoxirribonucléico EGFP – Proteína verde fluorescente FSH – Hormônio folículo-estimulante HCN – Nanotubos de haloisita
ICSI – Injeção intracitoplasmática de espermatozóides IVF – Fertilização in vitro
IVM – Maturação in vitro
NanoSMGT – Nanotransferência gênica mediada por espermatozóides NTC – Controle sem DNA
PCR – Reação em cadeia da polimerase
qPCR – Reação em Cadeia da Polimerase quantitativa SOF – Fluído sintético do oviducto
SUMÁRIO
1. INTRODUÇÃO GERAL ... 11
1.1. Animais transgênicos ... 11
1.2. Técnicas para a geração de animais transgênicos ... 13
1.3. Transferência gênica mediada por espermatozóides ... 14
1.4. Nanobiotecnologia e a transferência gênica mediada por espermatozóides ... 16
2. ARTIGO 1 ... 19
Abstract ... 21
1. Introduction ... 22
2. Materials and methods ... 23
3. Results ... 27 4. Discussion ... 28 References ... 31 Figure captions ... 36 3. ARTIGO 2 ... 39 Abstract ... 41 1. Introduction ... 42
2. Materials and methods ... 43
3. Results ... 52 4. Discussion ... 54 References ... 58 Figure Captions ... 64 4. CONCLUSÃO ... 67 5. REFERÊNCIAS ... 68
11 1 2 3 4 5 6 7 1. INTRODUÇÃO GERAL 8 9 1.1. Animais transgênicos 10 11
Na moderna biotecnologia o ano de 1982 foi marcado por dois 12
importantes eventos. Primeiro, neste ano deu-se início a comercialização da 13
insulina recombinante, produzida em bactérias, sendo este o primeiro produto 14
oriundo da engenharia genética utilizado na terapia de seres humanos. Ainda, 15
em dezembro deste ano, PALMITER et al., (1982), demonstraram pela primeira 16
vez a geração de um animal transgênico, através da microinjeção pronuclear 17
em embriões zigóticos de um fragmento de DNA contendo o promotor da 18
metalotioneína e o gene do hormônio do crescimento (GH) de ratos. Estes 19
animais geneticamente modificados apresentavam um crescimento muito 20
superior em ralação aos animais não-transgênicos. A partir daquele ano, os 21
animais transgênicos vêm sendo desenvolvidos para diversos propósitos, entre 22
eles a produção de proteínas recombinantes (LILLICO et al., 2007), o 23
melhoramento genético animal (MILAZZOTTO et al., 2010) e a geração de 24
modelos para estudos de doenças, principalmente para o câncer (WALRATH et 25
al., 2010). 26
A transgênese tornou-se uma importante ferramenta para o campo da 27
biologia e atualmente pelo menos 90% dos animais geneticamente modificados 28
são gerados para os estudos básicos. Estudos recentes têm demonstrado que 29
os animais transgênicos domésticos são mais apropriados para serem usados 30
como modelos para o estudo de doenças humanas (KUES; NIEMANN, 2011). 31
Um modelo de suíno transgênico para uma doença humana rara nos olhos 32
chamada retinitis pigmematosa foi desenvolvido recentemente (JAKOBSEN et 33
al., 2011). Embora os animais domésticos venham sendo desenvolvidos para 34
12
serem usados como modelos de doenças, os camundongos transgênicos ainda 1
são os modelos mais utilizados nesta área da transgênese, devido ao seu 2
baixo custo, rápida reprodução e fácil manipulação genética. 3
Por outro lado, os animais domésticos vêm sendo utilizados na 4
transgênese em duas principais frentes, na agricultura, contemplando o 5
melhoramento genético animal, e na saúde, para a produção de proteínas 6
recombinantes para terapia de doenças humanas. Suínos transgênicos com 7
superexpressão da α-lactoalbumina na glândula mamária induziram um maior 8
nível de lactose e produção de leite, aumentando, conseqüentemente a 9
sobrevivência e o desenvolvimento dos leitões (WHEELER; BLECK; 10
DONOVAN, 2001). Este aumento da sobrevivência dos leitões ao desmame 11
proporcionaria significativos benefícios comerciais para o produtor e à saude 12
dos animais. A proteína lisostafina confere resistência específica contra a 13
mastite causada por Staphylococcus aureus. Vacas transgênicas resistentes a 14
esta infecção foram produzidas por expressar o gene da lisostafina na glândula 15
mamária (WALL et al., 2005). Estes resultados demonstram a viabilidade de 16
produzir alterações significativas na composição do leite através da aplicação 17
de uma estratégia transgênica adequada. 18
Apesar das aplicações no melhoramento genético, os animais 19
domésticos transgênicos vêm sendo mais explorados para a produção de 20
proteínas recombinantes no conhecido gene pharming, que implica na 21
produção de proteínas recombinantes no leite de vacas, cabras ou ovelhas 22
(HOUDEBINE, 2009). A glândula mamária têm sido o fluido eleito com maior 23
freqüência para expressão de proteínas recombinantes devidos aos altos níveis 24
de proteína que podem ser produzidos e aos métodos para extração e 25
purificação já elucidados (KUES; NIEMANN, 2011). Vários produtos derivados 26
da glândula mamária de cabras e ovelhas transgênicas evoluíram para estágio 27
avançado de testes clínicos. Os ensaios clínicos de fase III para antitrombina III 28
(ATIII) (ATryn da GTC-Biotherapeutics, EUA), produzido na glândula mamária 29
de cabras transgênicas foi concluído e o produto recombinante foi aprovado 30
como droga terapêutica pela Agência Europeia de Medicamentos (EMA), em 31
agosto de 2006 e nos EUA pelo FDA em fevereiro de 2009. Esta proteína é o 32
primeiro produto a partir de um animal transgênico de produção a ser aceito 33
como uma droga totalmente registrada. O ATryn está registrado para o 34
13
tratamento de pacientes submetidos a procedimentos de circulação 1
extracorpórea que são resistentes à heparina. A GTC-Biotherapeutics também 2
já expressou pelo menos outras onze proteínas recombinantes na glândula 3
mamária de cabras transgênicas. 4
Anticorpos monoclonais também estão sendo produzidos na glândula 5
mamária de cabras transgênicas bem como em vacas transgênicas clonadas 6
que foram criadas para que produzam um anticorpo recombinante bi-específico 7
em seu sangue (GROSSE-HOVEST et al., 2004). Um desenvolvimento 8
interessante é a geração animais trans-cromossômicos portadores de um loci 9
com a seqüência completa da cadeia pesada e leve da imunoglobulina humana 10
em um cromossomo humano artificial (HAC). Este sistema é um passo 11
significativo na produção de anticorpos policlonais para terapêutica humana 12
(KUROIWA et al., 2009). Estudos de acompanhamento mostraram que o HAC 13
manteve-se em clones fundadores durante vários anos (ROBL et al., 2007). 14
Entretanto, ainda não se conhece como os HACs se manterão durante as 15
divisões celulares meióticas das células. 16
17
1.2. Técnicas para a geração de animais transgênicos 18
19
A produção de animais transgênicos é um trabalho intensivo e de alto 20
custo e depende de técnicas avançadas de biologia molecular, cultura de 21
células, biologia reprodutiva e bioquímica. O primeiro método de transferência 22
gênica bem sucedido em camundongos foi baseada na microinjeção de DNA 23
exógeno em pronúcleos zigóticos (GORDON et al., 1980; PALMITER et al., 24
1982). A injeção pronuclear de DNA também foi usada para produzir o primeiro 25
animal transgênico de produção a mais de 20 anos atrás (HAMMER et al., 26
1985). Apesar da ineficiência inerente da tecnologia de microinjeção, um amplo 27
espectro de organismos geneticamente modificados tem sido gerados para 28
aplicações na agricultura e na biomedicina. 29
Várias alternativas para a microinjeção de DNA pronuclear têm sido 30
desenvolvidas nos últimos anos para melhorar a eficiência e reduzir o custo da 31
geração de animais transgênicos. Estes incluem a transferência gênica 32
mediada por espermatozóides (CHANG et al., 2002; COLLARES et al., 2010), 33
a injeção intracitoplasmática de espermatozóides (ICSI) carregando DNA 34
14
exógeno (GARCIA-VAZQUEZ et al., 2010; PEREYRA-BONNET et al., 2011), a 1
injeção ou infecção de oócitos e/ou embriões por vetores retro e lentivirais 2
(HOFMANN et al., 2004) e o uso de transferência nuclear de células somáticas 3
(SCNT) (YANG et al., 2011). Até o presente momento, a SCNT tem sido bem 4
sucedida em mais de 16 espécies de mamíferos. Entretanto, a taxa de sucesso 5
desta técnica ainda é baixa, sendo geralmente, entre 1-3% a taxa de 6
transgênese dos embriões transferidos (MENDICINO et al., 2011). Os bovinos 7
parecem ser uma exceção a esta regra onde níveis 15-20% podem ser 8
alcançados (KUES; NIEMANN, 2011). 9
Das técnicas descritas acima, a transferência gênica mediada por 10
espermatozóides (SMGT) poderá tornar-se o método com melhor custo-11
benefício para a geração de animais transgênicos, o que aumentará 12
significantemente a aplicação dos animais transgênicos na produção comercial 13
e na pesquisa biomédica (KANG et al., 2008; CAMPOS et al., 2011a). 14
15
1.3. Transferência gênica mediada por espermatozóides 16
17
No início dos anos 70, BRACKETT et al. (1971) demonstraram que 18
moléculas de DNA exógeno poderiam ser incorporadas em um espermatozóide 19
de mamífero. Quase vinte anos depois, foi demonstrada a geração de 20
camundongos transgênicos após a fertilização de oócitos que foram 21
simplesmente incubados com o DNA alvo (LAVITRANO et al., 1989). Em 22
contraste com metodologias atuais de transferência de genes em animais de 23
produção como microinjeção de DNA em pró-núcleos fertilizados ou 24
transferência nuclear utilizando células de doadores transgênicos, que são de 25
trabalho, tempo ou custo intensivo (KUES; NIEMANN, 2011), a transferência 26
gênica mediada por espermatozóides (SMGT), provou ser reprodutível e seria 27
a mais simples e mais rápida maneira de produzir animais transgênicos 28
(LAVITRANO et al., 2006). Embora estudos anteriores tenham resultado na 29
criação de animais transgênicos em várias espécies, inclusive animais 30
marinhos invertebrados e peixes (LANES; SAMPAIO; MARINS, 2009; 31
COLLARES et al., 2010), aves (NAKANISHI; IRITANI, 1993; HAREL-32
MARKOWITZ et al., 2009), camundongos (MAIONE et al., 1998), porcos 33
(GARCIA-VAZQUEZ et al., 2010) e bovinos (SHEMESH et al., 2000; 34
15
HOELKER et al., 2007), a eficácia ainda é baixa devido a uma série de 1
problemas não resolvidos. 2
Um dos principais problemas da SMGT está relacionado com a baixa 3
incorporação de DNA exógeno pelo espermatozóide. Mesmo que a absorção 4
de DNA ocorra espontaneamente (ANZAR; BUHR, 2006), esta etapa é crítica, 5
porque o aumento captação DNA pelos espermatozóides, geralmente leva a 6
uma diminuição da motilidade e conseqüentemente da capacidade de 7
fertilização (FEITOSA et al., 2009). Portanto, novas estratégias como 8
eletroporação de espermatozóides (RIETH; POTHIER; SIRARD, 2000), 9
tratamento de espermatozóides com Triton-X (GARCIA-VAZQUEZ et al., 2009) 10
e use o de reagentes químicos de transfecção como lipossomas (HAREL-11
MARKOWITZ et al., 2009) ou DMSO (SHEN et al., 2006) foram desenvolvidos 12
para aumentar absorção de DNA exógeno em espermatozóides. No entanto, 13
mesmo que a freqüência de incorporação de DNA em espermatozóides seja 14
alta, a proporção de filhotes transgênicos permanece extremamente variável 15
(COLLARES et al., 2010). Além disso, a ação de enzimas DNases, que 16
degradam o DNA exógeno tanto no plasma seminal quanto no interior do 17
espermatozóide, pode influenciar significativamente de maneira negativa a 18
transferência do transgene para o oócito (LANES; SAMPAIO; MARINS, 2009; 19
COLLARES et al., 2010; CAMPOS et al., 2011a). Assim, mesmo que o 20
transgene seja transmitido com sucesso para o oócito, o gene repórter 21
raramente é expresso em um número expressivo de embriões e mesmo que os 22
genes exógenos sejam expressos pelo embrião transgênico pode ainda, haver 23
uma falta de integração ao genoma (SPADAFORA, 2007). Recentemente, 24
novos agentes transfectantes como nanocompósitos, tem sido usados para 25
proteger o DNA exógeno da ação destas DNases e assim incrementar o 26
processo de transfecção de DNA para as células espermáticas (CAMPOS et 27
al., 2011b). Além disso, novas estratégias como a transfecção de DNA para 28
espermatozóides sexados trazem a possibilidade de gerar animais 29
transgênicos com sexo predefinido através da SMGT (CECCO et al., 2010; 30
CAMPOS et al., 2011b). 31
Embora a principal aplicação da SMGT seja para a produção de animais 32
transgênicos, estão previstas aplicações na área humana, onde esta técnica 33
poderia ser usada para a transferência de genes na terapia gênica de 34
16
espermatozóides e testículos (PARRINGTON; COWARD; GADEA, 2011). 1
Entretanto, uma série de problemas ainda precisa ser resolvida, os 2
procedimentos para SMGT necessitam de grandes melhorias e novas 3
estratégias precisam ser desenvolvidas. 4
5
1.4. Nanobiotecnologia e a transferência gênica mediada por espermatozóides 6
7
A maioria dos nanocompósitos foram produzidos principalmente para 8
aplicações nas áreas de engenharia e de materiais, mas as tendências 9
recentes trouxeram essas ferramentas para as áreas da medicina e 10
biotecnologia. Desde o final dos anos 1970, as nanopartículas e 11
nanocompósitos têm sido utilizados para o conhecido drug delivery (KREUTER; 12
TAUBER; ILLI, 1979). Recentemente, os nanocompósitos como nanapartículas 13
e nanotubos vêm sendo utilizados como estratégia na terapia gênica devido às 14
suas propriedades que incrementam a transfecção de DNA para as células alvo 15
(DE LA FUENTE et al., 2006). A lipofecçao transporta os plasmídeos através 16
da membrana plasmática por endocitose, onde o seu tráfico intracelular tem 17
que continuar por uma via endossomal ou lisossomal. Isto faz com que a 18
maioria destas moléculas de DNA exógeno sejam degradadas por nucleases. 19
Este é também o caso quando o DNA exógeno é transfectado na ausência de 20
transfectantes – frequentemente utilizado na SMGT – onde os transgenes 21
internalizados são rapidamente degradados por DNases presente no esperma 22
(KANG et al., 2008; CAMPOS et al., 2011a). Além disso, DNases presentes no 23
líquido seminal também podem degradar moléculas de DNA exógeno. KIM et 24
al. (2010) demonstraram que, quando lipossomos foram utilizados, o 25
tratamento com DNase I reduziu significativamente a taxa de ligação a DNA 26
exógeno aos espermatozóides, e que quando nanopartículas magnéticas foram 27
utilizadas a redução na ligação foi significativamente menor. Foi demonstrado 28
que as nanopartículas magnéticas que estão vinculados ao DNA exógeno 29
podem se localizar tanto na parte interna da membrana plasmática ou no 30
interior da membrana plasmática, enquanto a maioria dos lipossomas localiza-31
se no exterior da membrana plasmática. 32
Vários nanopolímeros catiônicos ou dendrímeros têm sido utilizados 33
para incrementar a eficiência de transfecção tanto in vivo quanto in vitro (YAO 34
17
et al., 2009). Geralmente, esses agentes têm abundantes aminas primárias que 1
prontamente forma poliplexos com o DNA carregado negativamente e, 2
posteriormente, penetram para o ambiente endossomal, facilitando a liberação 3
de DNA para o citosol (FISCHER et al., 1999). Além disso, estudos anteriores 4
demonstraram que os nanotubos têm a capacidade de proteger o DNA 5
exógeno de clivagem enzimática por DNases. Os mecanismos de proteção 6
ainda não são bem compreendidos (WU et al., 2008), no entanto, a hipótese de 7
que nanotubos de sílica podem atuar como uma barreira física que protege os 8
materiais de danos na base de que nucleases celulares/proteínas não podem 9
ter acesso físico ao DNA (CHEN et al., 2005). 10
Tem sido sugerido que os nanotubos de haloisita (HCNs) podem ser 11
utilizados para a transfecção de DNA em células eucarióticas. HCNs são um 12
nanomaterial formado naturalmente com depósitos em vários países como os 13
EUA e no Brasil (LEVIS; DEASY, 2002). Os nanotubos de haloisita são 14
biocompatíveis e espontaneamente incorporados pelas células. Eles possuem 15
um lúmen interno cuja dimensão é compatível com muitas macromoléculas e 16
proteínas, permitindo a entrada e liberação de uma gama de agentes ativos 17
(VERGARO et al., 2010). Estas características fazem deste nanomaterial um 18
agente de transfecção potencialmente importante para o uso em SMGT. 19
No entanto, estudos utilizando nanopartículas para a transfecção de 20
células espermáticas ainda estão em um estágio inicial. Se o potencial da 21
nanobiotecnologia é fornecer produtos para as células, porque não utilizar este 22
potencial para a transfecção de DNA em espermatozóides? 23
Com base no exposto acima, o presente trabalho teve por objetivo 24
utilizar nanocompósitos como nanopolímeros e nanotubos para transfectar 25
DNA exógeno em espermatozóides bovinos e avaliar a eficiência destes 26
nanocompósitos em transmitir estas moléculas de DNA para embriões bovinos 27
através da técnica de NanoSMGT. 28
Os dados gerados nesta tese estão apresentados na forma de artigos 29
científicos. O primeiro artigo demonstra a transfecção de DNA exógeno em 30
espermatozóides bovinos sexados utilizando um nanopolímero catiônico. Este 31
trabalho foi publicado no periódico Theriogenology em 2011. 32
O segundo artigo demonstra que a técnica de NanoSMGT incrementa a 33
transmissão do transgene para embriões bovinos quando um nanopolímero 34
18
catiônico ou nanotubos de haloisita são utilizados para a transfecçao de DNA 1
em substituição de lipossomos ou DNA puro. Este trabalho foi aceito para 2
publicação também no periódico Theriogenology. 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
19 1 2 3 4 5 6 7 2. ARTIGO 1 8 9 10 11 12
NanoSMGT: transfection of exogenous DNA on sex-sorted bovine sperm
13
using nanopolymer
14 15
(Publicado no periódico Theriogenology, v.75, p.1476-1481, 2011.) 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32
20 NanoSMGT: transfection of exogenous DNA on sex-sorted bovine sperm
1
using nanopolymer
2 3
Vinicius F. Campos1, Eliza R. Komninou2, Gabriel Urtiaga1, Priscila M. de 4
Leon1, Fabiana K. Seixas1, Odir A. Dellagostin3, João Carlos Deschamps1, 5
Tiago Collares1* 6
7
1
Laboratório de Embriologia Molecular e Transgênese, 2In Vitro Sul Ltd.
8
Pesquisa e Desenvolvimento, 3Laboratório de Biologia Molecular, Núcleo de
9
Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade Federal
10
de Pelotas, Pelotas, RS
11 12
*Corresponding author: Centro de Desenvolvimento Tecnológico, Universidade 13
Federal de Pelotas, Campus Universitário s/nº, CEP 96010-900, Caixa Postal 14
354, Pelotas, RS, Brazil, Phone: +55 53 3275 7588, Fax: +55 3275 7551, E-15 mail: collares.t@gmail.com 16 17 18 19 20 21 22 23 24 25
21 Abstract
1
The objective was to introduce exogenous DNA into commercially sex-2
sorted bovine sperm using nanopolymer for transfection. In the first experiment, 3
the optimal concentration and ratio of linear-to-circular plasmid was determined 4
for NanoSMGT in unsorted sperm. A second experiment was conducted to 5
transfect exogenous DNA into sex-sorted sperm. Exogenous DNA uptake 6
occurred in a dose-dependent manner (P<0.05). The optimal amount of DNA 7
was 10 µg/106 cells. The ratios of linear-to-circular plasmid do not influence the 8
uptake by unsorted sperm cells and none of the tested treatments affected 9
sperm motility and viability. Commercially sex-sorted bovine sperm were able to 10
uptake exogenous DNA using nanopolymer; however, both X- and Y-sorted 11
sperm had decreased DNA uptake in comparison to unsorted sperm (P<0.05). 12
Neither sperm motility nor viability were affected by nanotransfection. In 13
conclusion, nanopolymer efficiently introduced exogenous DNA into 14
commercially sex-sorted bovine sperm; we inferred that these sperm could be 15
used for production of embryos of the desired sex, a technique named 16
NanoSMGT. 17
18
Keywords: NanoSMGT; Nanopolymer; Sperm-mediated gene transfer; Sexed
19
sperm; Cattle 20
22 1. Introduction
1 2
Sperm-mediated gene transfer (SMGT) has been applied to transgenesis 3
in many species [1-3]. This technique could become the most efficient and cost-4
effective technique to generate transgenic animals, which would substantially 5
increase their application in biomedical research and in commercial production, 6
although, its efficiency needs to be improved [4,5]. Several studies have 7
reported strategies to improve DNA uptake by sperm, including electroporation 8
[6], lipofection [7], and DMSO/DNA complex [8], although generation of 9
offspring was still low [9]. However, the successful use of nanostructures to 10
introduce foreign DNA into eukaryotic cells [10-12] has brought new 11
perspectives for production of transgenic embryos. Recently, Kim et al. [13] 12
obtained high transgenic rates for swine embryos after IVF using sperm 13
transfected with magnetic nanoparticles. 14
Bovine transgenesis has been exploited for several purposes, including 15
production of pharmaceutical proteins in cows [14], or increased muscle mass 16
in cattle [15]. The microinjection of plasmid DNA into early embryos represents 17
the state of the art in generating transgenic cattle. However, this approach 18
suffers from substantial drawbacks (e.g. mosaic distribution of the injected 19
transgene, late transgene integration at high copy numbers, and low 20
transgenesis frequency), making generation of transgenic lines a laborious task 21
[16]. Conversely, mass generation techniques, such as SMGT, have been 22
widely used to produce transgenic bovine embryos [5,7,17,18]. Thus, according 23
to the application of transgenic cattle, embryo sex selection becomes 24
necessary. Bovine sex-sorted sperm have been commercialized and 25
23
successfully used for production of embryos of the desired sex, without the 1
disadvantages of an embryo biopsy [19]. Today, high quality sex-sorted bovine 2
sperm is available in several countries at relatively low costs [20]. Recently, De 3
Cecco et al., [21] demonstrated the use of sex sorted sperm for production of 4
transgenic swine embryos. 5
The objective of the present study was to determine the ability of 6
commercially available cryopreserved sorted X and Y bovine sperm to uptake 7
exogenous DNA using nanopolymer as transfectant, a method named 8
NanoSMGT. 9
10
2. Materials and methods
11 12
2.1. Sperm source
13 14
Bovine sperm (X-sorted, Y-sorted and unsorted), from three Nelore bulls, 15
was purchased from CRV Lagoa Ltd. (São Paulo, SP, Brazil). According to the 16
supplier, there were 2 x 106 sperm in each sex-sorted dose, and 15 x 106 sperm 17
per straw of unsorted control semen. 18
19
2.2. Sperm nanotransfection
20 21
One frozen semen straw from each of the three bulls was thawed in a 22
water bath (35 °C for 30 s) and then pooled. Sperm were separated from 23
commercial cryopreservation media by centrifugation for 5 min at 250 × g, 24
suspended and maintained in Opti-MEM I medium (Invitrogen, Carlsbad, CA, 25
24
USA). Plasmid pEGFP-N1 (4.7 kb; Catalog #6085-1, Clontech Laboratories 1
Inc., Mountain View, CA, USA) was mixed with NanoFect Transfection Reagent 2
(Qiagen, Mississauga, ON, Canada) according to manufacturers’ instructions, 3
and incubated with sperm (1 × 106 cells) for 60 min at 38.5 °C and 5% (v/v) CO2
4
in air with high humidity. After incubation, sperm were washed three times in 5
OptiMEM I medium by centrifugation for 5 min at 600 × g and incubated with 20 6
U of DNase I (Invitrogen) for 30 min to remove exogenous DNA adsorbed on 7
the sperm surface, but not internalized. After DNase I treatment, sperm were 8
washed three more times in PBS (Ca2+ and Mg free) by centrifugation for 5 min 9
at 600 × g and the sperm pellet was subjected to DNA extraction. 10
11
2.3. Sperm motility and sperm viability analyses
12 13
Sperm motility was visually assessed in approximately 4-6 fields of 14
approximately 100 sperm each under a phase contrast microscope. Motility was 15
expressed as the average percentage of forward motile sperm of each sample. 16
Sperm viability was evaluated using the LIVE/DEAD® Sperm Viability Kit 17
(Invitrogen), according to manufacturer’s protocol. The number of red (dead) 18
and green cells (live) in a total of 100 sperm was counted in triplicate for each 19
sample under a fluorescence microscope. Viability was expressed as the 20
average percentage of viable sperm cells. Sperm motility and viability were 21
evaluated before and immediately after DNA incubation with sperm cells. All 22
evaluations were done independently by three persons, and data were 23
averaged. 24
25
2.4. Evaluation of DNA uptake by quantitative PCR
1 2
Template DNA for real-time PCR quantification was extracted from 3
nanotransfected sperm using the DNeasy Blood & Tissue Kit (Qiagen), 4
according to manufacturer’s protocol. Reactions were run using 1 ng of 5
template DNA on a Stratagene® Mx3005P™ Real-Time PCR System (Agilent 6
Technologies, Santa Clara, CA, USA), using Platinum® SYBR® Green qPCR 7
SuperMix UDG (Invitrogen). Primers for pEGFP vector (forward 5’ 8
CACGTCATTTTCCTCCTGCAT 3’, reverse 5’ GCATAGCGGCTCGTAGAGGTA 9
3’ were designed with Primer3 software (http://frodo.wi.mit.edu/primer3). Initial 10
validation experiments were conducted to ensure that primers had optimal PCR 11
efficiency. For quantification, a standard curve (Fig. 1) was generated using a 12
serial dilution of pEGFP plasmid (102 to 107 copies). Amplification was carried 13
out at cycling conditions of 95 ºC for 2 min, followed by 40 cycles at 95 ºC for 15 14
s, 51 ºC for 30 s, 72 ºC for 30 s followed by conditions to calculate the melting 15
curve. All PCR runs were performed in duplicate. 16
17
2.5. Experimental design
18 19
2.5.1. Experiment 1: Determination of optimal concentration and ratio of
linear-20
to-circular plasmid for nanotransfection in unsorted sperm
21 22
In order to determine the most efficient nanotransfection protocol, sperm 23
were incubated with 0.1, 1, and 10 µg of exogenous DNA. Also, for each 24
plasmid concentration, three linear-to-circular DNA ratios were tested: only 25
26
linear (L), linear and circular (1:1; L:C), and only circular (C). The pEGFP vector 1
was linearized with the restriction enzyme NotI and purified with GFX PCR DNA 2
and Gel Band Purification Kit (GE Healthcare©, Buckinghamshire, UK). Sperm 3
motility and viability were evaluated before and after incubation, followed by 4
quantification of exogenous DNA uptake by sperm cells. This experiment was 5
replicated three times using separate pools of frozen-thawed semen. 6
7
2.5.2. Experiment 2: Exogenous DNA nanotransfection of sex-sorted sperm
8 9
The objective of this experiment was to investigate the ability of sex-10
sorted bovine sperm to uptake exogenous DNA after nanopolymer transfection. 11
Using the most efficient plasmid concentration in the previous experiment, X-12
sorted, Y-sorted, and unsorted sperm were incubated with three linear-to-13
circular DNA ratios, as described above. Sperm incubated without exogenous 14
DNA and nanopolymer for each group was used as a control. Sperm motility, 15
viability, and quantification of DNA uptake were performed as previously 16
described. This experiment was repeated three times using separate pools of 17 frozen-thawed semen. 18 19 2.6. Data analyses 20 21
Linear regression was used to evaluate the standard curve of plasmid 22
serial dilution. Sperm motility and viability, before and after incubation, were 23
compared using a Student’s paired t-test. That the data were normally 24
distributed was verified using a Kolmogorov-Smirnov’s test. In Experiment one, 25
27
a square root transformation was performed to normalize DNA uptake data. 1
Quantification of exogenous DNA uptake was compared using two-way 2
ANOVA, followed by a Tukey test for multiple comparisons. The parameters 3
evaluated in the first experiment were “linear-to-circular plasmid ratio (L, L:C 4
and C)” and “exogenous DNA concentration”. The parameters evaluated in the 5
second experiment were “sperm type (Unsorted, X-sorted and Y-sorted)” and 6
“linear-to-circular plasmid ratio (L, L:C and C)”. Significance was considered at 7
P<0.05 in all analyses. All data were expressed as mean ± SEM. 8 9 3. Results 10 11
3.1. Exogenous DNA optimal concentration and ratio of linear-to-circular
12
plasmid in unsorted sperm
13 14
The use of nanopolymer was efficient for sperm transfection. The linear-15
to-circular plasmid ratio did not affect the uptake of exogenous DNA (P = 16
0.2453). However, exogenous DNA uptake occurred in a dose-dependent 17
manner, increasing as availability of DNA for transfection increased (P<0.0001, 18
Fig. 2a). Only linearized plasmid DNA at a concentration of 1 µg resulted in 19
reduced sperm viability (P<0.05, Fig. 2c). No significant differences were found 20
in other treatments regarding sperm motility and viability evaluated before and 21
immediately after incubation with exogenous DNA, even at high DNA 22
concentrations, or various linear-to-circular plasmid ratios (Fig. 2b, 2c). 23
24
3.2. Uptake of exogenous DNA by sex-sorted sperm
28
1
From the results of previous experiment, 10 µg of plasmid was chosen to 2
test the optimal ratio of linear-to-circular plasmid to maximize the uptake of 3
exogenous DNA by commercially sex-sorted sperm, using nanopolymer. The 4
ratio of linear-to-circular plasmid did not affect the uptake of exogenous DNA, 5
independent of the sorting procedure (P = 0.9188). Both X- and Y-sorted sperm 6
had lower uptake of plasmids (P = 0.0004) in comparison to unsorted sperm. 7
However, in X-sorted sperm incubated with circular plasmid, uptake was similar 8
to unsorted sperm (Fig. 3a). In X-sorted sperm, sperm motility was reduced 9
after incubation with circular DNA; conversely, motility was also reduced for 10
sperm incubated without exogenous DNA (Control, Fig. 3b). Similarly, X-sorted 11
sperm, treated with any linear-to-circular plasmid ratio or not treated (control) 12
had reduced sperm viability (Fig. 3c). We inferred that this reduction was 13
caused by incubation time and not by exogenous DNA, since sperm motility and 14
viability was also reduced in controls. As demonstrated for unsorted sperm, in 15
other treatments sperm motility and sperm viability were not affected by 16
exogenous DNA (Fig. 3b, 3c). 17 18 4. Discussion 19 20
In the current study, the efficient introduction of exogenous DNA into sex-21
sorted bovine sperm using nanopolymer as transfectant was demonstrated. To 22
our knowledge, this is the first report of bovine SMGT using commercially sex-23
sorted sperm associated to nanocomposites for exogenous DNA transfection. In 24
the past decade, several cationic nanopolymers have been demonstrated to 25
29
display considerable transfection efficiency in vivo and in vitro [22]. Generally 1
they have abundant primary amines which readily form polyplexes with 2
negatively charged DNA and subsequently buffer the endosomal environment, 3
facilitating the release of DNA into the cytosol [23]. Previously, magnetic 4
nanoparticles were successfully used to promote introduction of exogenous 5
DNA into boar sperm and subsequently production of transgenic embryos [13]. 6
Several studies on bovine SMGT have reported divergences on 7
exogenous DNA concentration and its uptake by sperm, ranging from 0.1 to 10 8
µg [5,7,18]. Conversely, other approaches have been tested to increase DNA 9
uptake, such as the use of liposomes [7]. In the present study, using 10
nanopolymer, 10 µg/106 cells was the optimal concentration of DNA for 11
unsorted sperm nanotransfection. In previous reports, large amounts of 12
exogenous DNA associated with sperm triggered endonuclease activation, 13
resulting in exogenous and endogenous DNA degradation in an apoptosis-like 14
process [18,19,24,25]. However, exogenous DNA did not induce DNA 15
fragmentation in bovine sperm [18]. Furthermore, Anzar and Buhr [5] reported 16
decreases bovine sperm viability using 0.5 µg/0.25 x 106 cells. However, in the 17
present study, even the highest DNA concentration used did not decrease 18
sperm motility and viability; therefore, we inferred that nanotransfected sperm 19
could be used for IVF or even AI. 20
As suggested by Li et al. [20,26] and Collares et al., [2] the ratio of linear-21
to-circular DNA can influence exogenous DNA uptake by sperm cells. In the 22
present study, nanopolymer complexed with linear, a mixture of linear and 23
circular, or circular plasmid did not influence the amount of DNA uptake. These 24
30
results were noteworthy, since synthetic constructions that sometimes are only 1
available as linear structure could be used without affecting DNA internalization. 2
Interestingly, the uptake of exogenous DNA by sex sorted sperm was 3
reduced in comparison to unsorted sperm. Sexing sperm by high-speed flow-4
cytometry subjects them to various stresses, including high dilution, Hoechst 5
nuclear staining, high pressure, mechanical forces associated with passage 6
through the sorter, exposure to UV laser beam, electrical charge, and projection 7
into the collection tube at high speed [27-30]. As demonstrated by Spinaci et al. 8
[31], sperm sorting induces a re-distribution of hsp70, a protein that plays a role 9
during sperm-oocyte membrane interaction [32]. In mammals, 30-35 kDa sperm 10
proteins positively interact with exogenous DNA, allowing internalization by the 11
sperm nucleus [33]. Perhaps sperm proteins other than 30-35 kDa may be 12
affected by the sorting procedure, potentially changing the localization of these 13
proteins, and interfering with DNA internalization by sperm. Future studies 14
should be conducted to elucidate these mechanisms. 15
De Cecco et al. [21] did not evaluate the incorporation of exogenous 16
DNA for Y- or X-sorted; however, they reported that sorted sperm treated with 17
exogenous DNA was able to produce transgenic embryos. Therefore, we 18
inferred that the lower DNA uptake in sex-sorted sperm should not interfere with 19
production of sex-selected transgenic bovine embryos by NanoSMGT, since 20
previous studies reported production of transgenic embryos with sperm that had 21
taken up small amounts of exogenous DNA [3]. In addition, in recent studies, 22
nanotransfectants protected DNA strands against nucleases during cellular 23
delivery [34]. Specifically, DNA vector were protected from enzymatic cleavage 24
and interference from nucleic acid binding proteins, increasing the transgene 25
31
internalization success. Our nanotransfection protocol did not decrease sperm 1
motility and viability of sorted sperm. The reduction of sperm viability in the X-2
sorted sperm after incubation was not attributed to exogenous DNA, since the 3
control group also had a decreased number of viable sperm; perhaps this 4
reduction was caused by incubation time, as previously demonstrated [35]. 5
In summary, our study demonstrated for the first time the use of 6
nanopolymer to introduce exogenous DNA into bovine sex-sorted sperm. There 7
was no loss of sperm motility and viability; therefore, we concluded that 8
NanoSMGT could be used for production of sex-selected, transgenic bovine 9 embryos. 10 11 Acknowledgements 12 13
This work was supported by Brazilian CNPq and FAPERGS. Both V. F. 14
Campos and P.M. de Leon are students of the Graduate Program in 15
Biotechnology at Universidade Federal de Pelotas and are supported by 16
Brazilian CAPES, whereas J.C. Deschamps and O.A. Dellagostin are research 17 fellows of CNPq. 18 19 References 20 21
[1] Harel-Markowitz E, Gurevich M, Shore LS, Katz A, Stram Y, Shemesh M. 22
Use of sperm plasmid DNA lipofection combined with REMI (restriction 23
enzyme-mediated insertion) for production of transgenic chickens 24
32
expressing eGFP (enhanced green fluorescent protein) or human follicle-1
stimulating hormone. Biol Reprod 2009;80:1046-52. 2
[2] Collares T, Campos VF, Seixas FK, et al. Transgene transmission in South 3
American catfish (Rhamdia quelen) larvae by sperm-mediated gene 4
transfer. J Biosci 2010;35:39-47. 5
[3] Lavitrano M, Busnelli M, Cerrito MG, Giovannoni R, Manzini S, Vargiolu A. 6
Sperm-mediated gene transfer. Reprod Fertil Dev 2006;18:19-23. 7
[4] Kang JH, Hakimov H, Ruiz A, Friendship RM, Buhr M, Golovan SP. The 8
negative effects of exogenous DNA binding on porcine spermatozoa are 9
caused by removal of seminal fluid. Theriogenology 2008;70:1288-96. 10
[5] Anzar M, Buhr MM. Spontaneous uptake of exogenous DNA by bull 11
spermatozoa. Theriogenology 2006;65:683-90. 12
[6] Gagne MB, Pothier F, Sirard MA. Electroporation of bovine spermatozoa to 13
carry foreign DNA in oocytes. Mol Reprod Dev 1991;29:6-15. 14
[7] Hoelker M, Mekchay S, Schneider H, et al. Quantification of DNA binding, 15
uptake, transmission and expression in bovine sperm mediated gene 16
transfer by RT-PCR: effect of transfection reagent and DNA architecture. 17
Theriogenology 2007;67:1097-107. 18
[8] Shen W, Li L, Pan Q, Min L, Dong H, Deng J. Efficient and simple production 19
of transgenic mice and rabbits using the new DMSO-sperm mediated 20
exogenous DNA transfer method. Mol Reprod Dev 2006;73:589-94. 21
[9] Spadafora C. Sperm-mediated gene transfer: mechanisms and implications. 22
Soc Reprod Fertil Suppl 2007;65:459-67. 23
[10] Liu WT. Nanoparticles and their biological and environmental applications. 24
J Biosci Bioeng 2006;102:1-7. 25
33
[11] Arruebo M, Fernandez-Pacheco R, Ibarra MR, Santamaria J. Magnetic 1
nanoparticles for drug delivery. Nano Today 2007;23:22-32. 2
[12] Zohra FT, Chowdhury EH, Akaike T. High performance mRNA transfection 3
through carbonate apatite-cationic liposome conjugates. Biomaterials 4
2009;30:4006-13. 5
[13] Kim TS, Lee SH, Gang GT, et al. Exogenous DNA Uptake of Boar 6
Spermatozoa by a Magnetic Nanoparticle Vector System. Reprod 7
Domest Anim 2009. 8
[14] Zhang Y, Luo J, Bi J, et al. Efficient separation of homologous alpha-9
lactalbumin from transgenic bovine milk using optimized hydrophobic 10
interaction chromatography. J Chromatogr A 2010;1217:3668-73. 11
[15] Milazzotto MP, Goissis MD, Feitosa WB, et al. Myostatin gene knockdown 12
through lentiviral-mediated delivery of shRNA for in vitro production of 13
transgenic bovine embryos. Zygote 2010; 18:339-44. 14
[16] Soroldoni D, Hogan BM, Oates AC. Simple and efficient transgenesis with 15
meganuclease constructs in zebrafish. Methods Mol Biol 2009;546:117-16
130 17
[17] Shemesh M, Gurevich M, Harel-Markowitz E, Benvenisti L, Shore LS, 18
Stram Y. Gene integration into bovine sperm genome and its expression 19
in transgenic offspring. Mol Reprod Dev 2000;56:306-8. 20
[18] Feitosa WB, Mendes CM, Milazzotto MP, et al. Exogenous DNA uptake by 21
bovine spermatozoa does not induce DNA fragmentation. 22
Theriogenology 2010; 74:563-8. 23
[19] Seidel GE, Jr. Economics of selecting for sex: the most important genetic 24
trait. Theriogenology 2003;59:585-98. 25
34
[20] Garner DL, Seidel GE, Jr. History of commercializing sexed semen for 1
cattle. Theriogenology 2008;69:886-95. 2
[21] De Cecco MD, Spinaci M, Zannoni A, Bernardini C, Seren E, Forni M, 3
Bacci ML. Coupling sperm mediated gene transfer and sperm sorting 4
techniques: a new perspective for swine transgenesis. Theriogenology 5
2010;74:856-62. 6
[22] Yao H, Ng SS, Tucker WO, Tsang YK, Man K, Wang XM, Chow BK, Kung 7
HF, Tang GP, Lin MC. The gene transfection efficiency of a folate-8
PEI600-cyclodextrin nanopolymer. Biomaterials 2009;30:5793-803. 9
[23] Fischer D, Bieber T, Li Y, Elsasser HP, Kissel T. A novel non-viral vector 10
for DNA delivery based on low molecular weight, branched 11
polyethylenimine: effect of molecular weight on transfection efficiency 12
and cytotoxicity. Pharm Res 1999;16:1273-9. 13
[24] Maione B, Pittoggi C, Achene L, Lorenzini R, Spadafora C. Activation of 14
endogenous nucleases in mature sperm cells upon interaction with 15
exogenous DNA. DNA and Cell Biol 1997;16:1087-97. 16
[25] Spadafora C. Sperm cells and foreign DNA: a controversial relation. 17
Bioessays 1998;20:955-64. 18
[26] Li L, Shen W, Min LJ, Dong HS, Sun YJ, Pan QJ. Human lactoferrin 19
transgenic rabbits produced efficiently using dimethylsulfoxide-sperm-20
mediated gene transfer. Reprod Fertil Dev 2006;18:689-95. 21
[27] Maxwell WM, Johnson LA. Physiology of spermatozoa at high dilution 22
rates: the influence of seminal plasma. Theriogenology 1999;52:1353-62. 23
[28] Johnson LA. Sexing mammalian sperm for production of offspring: the 24
state-of-the-art. Anim Reprod Sci 2000;60:93-107. 25
35
[29] Spinaci M, De Ambrogi M, Volpe S, Galeati G, Tamanini C, Seren E. Effect 1
of staining and sorting on boar sperm membrane integrity, mitochondrial 2
activity and in vitro blastocyst development. Theriogenology 3
2005;64:191-201. 4
[30] De Ambrogi M, Spinaci M, Galeati G, Tamanini C. Viability and DNA 5
fragmentation in differently sorted boar spermatozoa. Theriogenology 6
2006;66:1994-2000. 7
[31] Spinaci M, Volpe S, Bernardini C, de Ambrogi M, Tamanini C, Seren E, 8
Galeati G. Sperm sorting procedure induces a redistribution of Hsp70 but 9
not Hsp60 and Hsp90 in boar spermatozoa. J Androl 2006;27:899-907. 10
[32] Spinaci M, Volpe S, Bernardini C, De Ambrogi M, Tamanini C, Seren E, 11
Galeati G. Immunolocalization of heat shock protein 70 (Hsp 70) in boar 12
spermatozoa and its role during fertilization. Mol Reprod Dev 13
2005;72:534-41. 14
[33] Zani M, Lavitrano M, French D, Lulli V, Maione B, Sperandio S, Spadafora 15
C. The mechanism of binding of exogenous DNA to sperm cells - factors 16
controlling the DNA uptake. Exp Cell Res 1995;217:57-64. 17
[34] Wu Y, Phillips JA, Liu H, Yang R, Tan W. Carbon nanotubes protect DNA 18
strands during cellular delivery. ACS Nano 2008;2:2023-8. 19
[35] Feitosa WB, Milazzotto MP, Simoes R, et al. Bovine sperm cells viability 20
during incubation with or without exogenous DNA. Zygote 2009;17:315-21 20. 22 23 24 25
36 Figure captions
1 2
Figure 1. Standard curve of serial dilution of pEGFP plasmid (102 to 107 copies). The slope,
3
regression coefficient, and primer efficiency are shown.
4 5 102 103 104 105 106 107 0 5 10 15 20 25 30 35 40 Slope = - 3.25, r2 = 0.999, Eff = 103%
Initial quantity (copies)
Cyc le t h re s h o ld ( Ct ) 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
37 Fig. 2. Nanotransfection in unsorted sperm. In all figures, data are expressed as means ± SEM
1
(N = 3). a) Evaluation of DNA uptake by quantitative PCR at various concentrations and ratios
2
of linear-to-circular plasmid, showing increases in DNA uptake in a dose-dependent manner.
3
Amplification in the control group without exogenous DNA was not detected. a-cDifferences
4
among amounts of exogenous DNA (P<0.0001). There were no differences (P=0.2453) were
5
among various linear-to-circular ratios in all treatments. This graph has square root transformed
6
data. b) Sperm motility before and after incubation with exogenous DNA. c) Sperm viability
7
before and after incubation with exogenous DNA. *Difference (P<0.05) between means before
8
and after incubation.
9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Ctrl 0.1 1 10 0 51001 11002 21002 Linear Linear : Circular Circular a b c DNA quantity (g) In te rn a liz e d p la s m id s / 1 0 6 s p e rm Ctrl L L:C C L L:C C L L:C C 0 20 40 60
80 Before DNA incubation
After DNA incubation
0.1g 1g 10g Treatments S p e rm m o ti lit y ( % ) Ctrl L L:C C L L:C C L L:C C 0 20 40 60
80 Before DNA incubation
After DNA incubation
0.1g 1g 10g * Treatments S p e rm vi a b ili ty (% )
a)
b)
c)
38 Fig. 3. Nanotransfection in sex-sorted spermatozoa. Data are expressed as means ± SEM (N =
1
3). a) Evaluation of DNA uptake by quantitative PCR at various ratios of linear-to-circular
2
plasmid in unsorted, X and Y sorted sperm, with reduction in DNA uptake by sex-sorted sperm.
3
Amplification in the control group (without exogenous DNA) was not detected, thus they do not
4
appear in the graph. A,BTreatments without a common superscript differ (P=0.0004). a,bWithin
5
linear-to-circular plasmid ratios, numbers without a common superscript differ (P=0.0004). b)
6
Sperm motility before and after incubation with exogenous DNA. c) Sperm viability before and
7
after incubation with exogenous DNA. *Difference (P<0.05) between means before and after
8 incubation. 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35
Unsorted X - sorted Y - sorted 0 11008 21008 31008 Linear Linear : Circular Circular Aa Aa Aa Bb Bb Bb Bb Bb Bb Treatments In te rn a liz e d p la s m id s / 1 0 6 s p e rm C trl L L:C C C trl L L:C C C trl L L:C C 0 20 40 60
80 Before DNA incubation
After DNA incubation
Unsorted X - sorted * * Y - sorted Treatments S p e rm m o ti lit y (% ) Ctrl L L:C C Ctrl L L:C C Ctrl L L:C C 0 20 40 60 80
Before DNA incubation After DNA incubation
Unsorted X - sorted Y -sorted
* * * * Treatments S p e rm v ia b ili ty ( % )
a)
b)
c)
39 1 2 3 4 5 6 7 3. ARTIGO 2 8 9 10 11 12
NanoSMGT: transgene transmission into bovine embryos using halloysite
13
clay nanotubes or nanopolymer to improve transfection efficiency
14 15
(Publicado no periódico Theriogenology, in press) 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
40 NanoSMGT: transgene transmission into bovine embryos using halloysite
1
clay nanotubes or nanopolymer to improve transfection efficiency
2 3
Vinicius Farias Campos1, Priscila Marques Moura de Leon1, Eliza Rossi 4
Komninou1, Fabiana Kömmling Seixas2, Odir Antônio Dellagostin3, João Carlos 5
Deschamps1, Tiago Collares1* 6
7
1
Laboratório de Embriologia Molecular e Transgênese, Núcleo de
8
Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade Federal
9
de Pelotas, Pelotas, RS, Brazil
10
2
Laboratório de Genômica Funcional, Núcleo de Biotecnologia, Centro de
11
Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS,
12
Brazil
13
3
Laboratório de Biologia Molecular, Núcleo de Biotecnologia, Centro de
14
Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Pelotas, RS,
15
Brazil
16 17
*Corresponding author: Centro de Desenvolvimento Tecnológico, Universidade 18
Federal de Pelotas, Campus Universitário s/nº, CEP 96010-900, Caixa Postal 19
354, Pelotas, RS, Brazil, Phone: +55 53 3275 7588, Fax: +55 3275 7551, E-20
mail: collares.t@gmail.com 21
41 Abstract
1
The objectives were to investigate whether: 1) nanotransfectants are more 2
effective than other common transfection methods for SMGT; 2) NanoSMGT is able 3
to transmit exogenous DNA molecules to bovine embryos; and 3) halloysite clay 4
nanotubes (HCNs) can be used as a transfection reagent to improve transgene 5
transmission. Four transfection systems were used: naked DNA (without 6
transfectant), lipofection, nanopolymer, and halloysite clay nanotubes. Plasmid 7
uptake by sperm and its transfer to embryos were quantified by conventional and 8
real-time PCR, as well as EGFP expression by florescence microscopy. Furthermore, 9
sperm motility and viability, and embryo development were investigated. Mean 10
number of plasmids taken up was affected (P<0.05) by transfection procedure, with 11
the nanopolymer being the most effective transfectant (~ 153 plasmids per 12
spermatozoon). None of the treatments affected sperm motility or viability. The mean 13
number of plasmids transmitted to four-cell stage embryos was higher (P<0.05) in 14
nanopolymer and HCNs than liposomes and naked DNA groups. The number of 15
embryos carrying the transgene increased from 8-10% using naked DNA or 16
liposomes to 40-45% using nanopolymer or HCN as transfectants (P<0.05). There 17
were no significant differences among transfection procedures regarding blastocyst 18
formation rate of resulting embryos. However, no EGFP-expressing embryo was 19
identified in any treatment. Therefore, nanotransfectants improved transgene 20
transmission in bovine embryos without deleterious effects on embryo development. 21
To our knowledge, this was the first time that bovine embryos carrying a transgene 22
were produced by NanoSMGT. 23
24
Keywords: SMGT; Halloysite clay nanotubes; Nanopolymer; Cattle; Exogenous DNA 25
42 1. Introduction
1 2
Over the past 30 y, several methods to generate transgenic animals have 3
been developed [1-3]. The most common methods have been pronuclear 4
microinjection, somatic cell nuclear transfer, retroviral vectors, and most recently, 5
embryonic-stem cell transgenesis. The use of sperm for transgenesis has been 6
studied, and several distinct approaches have been developed; however, the 7
efficiency of such sperm-mediated gene transfer (SMGT) needs to be radically 8
improved [4,5]. The limited uptake of exogenous DNA and its subsequent 9
degradation by sperm, remain the primary factors underlying the low efficiency of this 10
technique [6-9]. 11
Several approaches have been utilized in order to improve DNA uptake. 12
Methods such as electroporation, lipofection, DNA/DMSO complexes and restriction-13
enzyme-mediated integration (REMI) have been used; however the frequency of 14
transgenic offspring remains low [10-13]. Conversely, the more recent use of 15
nanotechnology in the context of SMGT has new possibilities for the efficient delivery 16
of exogenous DNA into sperm. For example, Kim et al [14] obtained high transgenic 17
rates for swine embryos after in vitro fertilization using sperm transfected with 18
magnetic nanoparticles. Recently, we successfully demonstrated exogenous DNA 19
uptake by bovine sperm using a nanopolymer as the transfectant, providing a new 20
tool to improve transgenic bovine embryo production [11]. 21
Functional nanometer-scale containers have been successfully used to deliver 22
pharmaceuticals and nucleic acid molecules into animal cells and tissues. In this 23
regard, halloysite clay nanotubes (HCNs) are of particular interest. They are a natural 24
nanomaterial, with deposits in several countries, including the USA and Brazil [15]. 25
43
Halloysite clay nanotubes (HCNs) are biocompatible and spontaneously incorporated 1
by cells. The diameter of their inner lumen is compatible with many macromolecules 2
and proteins, allowing the entrapping and subsequent slow release of a range of 3
active agents [16]. These characteristics make this nanomaterial a potentially 4
functional transfection agent for use in bovine SMGT. 5
Bovine transgenesis has been exploited for several purposes, including 6
production of pharmaceutical proteins in cows [17] and increased muscle mass in 7
cattle [18]. The microinjection of plasmid DNA into early embryos represents the state 8
of the art in generating transgenic cattle. However, this approach has substantial 9
drawbacks (e.g. mosaic distribution of the injected transgene, late transgene 10
integration at high copy numbers, and low transgenesis frequency), making 11
generation of transgenic lines laborious [19]. Conversely, mass generation 12
techniques, such as SMGT, represent a potentially important alternative means of 13
producing transgenic bovine embryos [6,11,20-23]. 14
Based on our previous results demonstrating that NanoSMGT can be an 15
effective technique for the introduction of exogenous DNA into bovine sperm [11], our 16
objective in the present study was to transmit a transgene to bovine embryos through 17
NanoSMGT, using nanopolymer or HCNs as transfection agents. 18
19
2. Materials and methods
20 21
2.1. Sperm source and experimental design
22 23
Sperm from three Nelore bulls was purchased from CRV Lagoa Ltd. (São 24
Paulo, SP, Brazil). According to the supplier, there were 15 x 106 sperm per straw. 25
44
1
2.2. Sperm transfection procedures
2 3
One frozen semen straw from each of the three bulls was thawed in a water 4
bath (35 °C for 30 s) and all semen pooled. Sperm were separated from commercial 5
cryopreservation media by centrifugation for 5 min at 250 × g, suspended and 6
maintained in Opti-MEM I medium (Invitrogen, Carlsbad, CA, USA). For all 7
transfection procedures, plasmid pEGFP-N1 (4.7 kb; Catalog #6085-1, Clontech 8
Laboratories Inc., Mountain View, CA, USA) was used at 10 µg of final quantity and 9
1:1 (linear:circular) plasmid ratio, the best arrangement for exogenous DNA uptake 10
by bovine sperm [11]. Linearization was performed using the restriction enzyme NotI 11
and plasmid was purified with GFX PCR DNA and Gel Band Purification Kit (GE 12
Healthcare©, Buckinghamshire, UK). Sperm transfection was performed using the 13
same sperm pool at 1 × 106 sperm per transfection procedure. Four transfection 14
treatments were conducted: 1) naked exogenous DNA (without any trasfectant), 2) 15
lipofection using Lipofectamine 2000 (Invitrogen), 3) transfection using nanopolymer 16
(NanoFect Transfection Reagent, Qiagen, Mississauga, ON, Canada), and 4) 17
halloysite clay nanotubes (HCNs; Sigma-Aldrich, St. Louis, MO, USA). Also, sperm 18
without DNA transfection was used for IVF as a control group. 19
20
2.2.1. Transfection using Liposome
21 22
Lipofectamine 2000 was prepared according the manufacturer's instructions. 23
Two solutions were prepared: Solution A: 10 μg of 1:1 linear-to-circular plasmid 24
ratio/50 μL Opti-MEM I; and Solution B: 10 μg Lipofectamine/50 μL Opti-MEM I. 25
