• Nenhum resultado encontrado

Expression of heparanase in basal cell carcinoma and squamous cell carcinoma

N/A
N/A
Protected

Academic year: 2021

Share "Expression of heparanase in basal cell carcinoma and squamous cell carcinoma"

Copied!
6
0
0

Texto

(1)

Expression of heparanase in basal cell carcinoma and

squamous cell carcinoma

*

Maria Aparecida Silva Pinhal

1,2

Maria Carolina Leal Almeida

2

Alessandra Scorse Costa

1

Thérèse Rachell Theodoro

1,2

Rodrigo Lorenzetti Serrano

1

Carlos D´Apparecida Santos Machado Filho

1

DOI: http://dx.doi.org/10.1590/abd1806-4841.20164957

Abstract: Background

: Heparanase is an enzyme that cleaves heparan sulfate chains. Oligosaccharides generated by heparan-ase induce tumor progression. Basal cell carcinoma and squamous cell carcinoma comprise types of nonmelanoma skin cancer. oBjectives : Evaluate the glycosaminoglycans profile and expression of heparanase in two human cell lines established in cul- ture, immortalized skin keratinocyte (HaCaT) and squamous cell carcinoma (A431) and also investigate the expression of hep-aranase in basal cell carcinoma, squamous cell carcinoma and eyelid skin of individuals not affected by the disease (control). Methods: Glycosaminoglycans were quantified by electrophoresis and indirect ELISA method. The heparanase expression was analyzed by quantitative RT-PCR (qRTPCR). results: The A431 strain showed significant increase in the sulfated glycosaminoglycans, increased heparanase expression and decreased hyaluronic acid, comparing to the HaCaT lineage. The mRNA expression of heparanase was significantly higher in Basal cell carcinoma and squamous cell carcinoma compared with control skin samples. It was also observed increased hepa-ranase expression in squamous cell carcinoma compared to the Basal cell carcinoma. conclusion: The glycosaminoglycans profile, as well as heparanase expression are different between HaCaT and A431 cell lines. The increased expression of heparanase in Basal cell carcinoma and squamous cell carcinoma suggests that this enzyme could be a marker for the diagnosis of such types of non-melanoma cancers, and may be useful as a target molecule for future alternative treatment. Keywords: Carcinoma, basal cell; Carcinoma, squamous cell; Glycosaminoglycans; Hyaluronic acid; Neoplasms; Polymerase chain reaction; Skin neoplasms

s

Received on 21.07.2015. Approved by the Advisory Board and accepted for publication on 17.11.2015. * Work conducted at the Faculdade de Medicina do ABC (FMABC) and the Universidade Federal de São Paulo (UNIFESP), São Paulo, SP, Brazil. Financial Support: FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo); CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnologia); CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior) Conflict of Interest: None. 1 Faculdade de Medicina do ABC (FMABC), Santo André, SP, Brazil. 2 Universidade Federal de São Paulo (UNIFESP), São Paulo, SP, Brazil. ©2016 by Anais Brasileiros de Dermatologia INTRODUCTION

According to data from the National Cancer Institute (INCA), nonmelanoma skin cancer is the most common cancer in Brazil. It corresponds to 33% of all malignant tumors in the coun-try, and presents low mortality and high cure rates when detect-ed early on. Of the types of nonmelanoma skin cancer, basal cell carcinoma (BCC) is the most common, responsible for 70% of the diagnoses, while squamous cell carcinoma (SCC), is responsible for approximately 25% of the cases. These tumors present differences in behavior, growth, and metastatic capacity.1 Both BCC and SCC

present good prognoses, especially if detected in their initial stages.2

The BCC consisting of cells that resemble epidermal basal cells is the least aggressive of the types of skin cancer.3 BCC is a

tumor with a low degree of malignancy, with the capability of local invasion, tissue destruction, recurrence, and a limited potential of metastasis.4 BCC is formed by the atypical proliferation of squamous

cells, of an invader nature, which can provoke metastasis.5 SCC

presents a considerable potential for recurrence, which is associated with the size of the tumor, degree of histological differentiation, depth of the lesion, perineural invasion, state of the patient’s immune system, and anatomic detection.6

(2)

Individuals that develop BCC present a high risk of devel-oping new foci of basal carcinomas, as well as other types of skin cancer, such as melanomas and SCCs.7

Exposure to ultraviolet radiation is the main risk factor asso-ciated with the genesis of BCC and SCC, which is evident due to its greater occurrence when exposed to sunlight.8 Studies suggest that

the exposure to chronic UVB radiation activates heparanase, leading to the degradation of the heparin sulfate in the basal membrane and the increase in the interaction between the growth factor of the epidermis and the dermis.9

The skin itself contains a large quantity of hyaluronic acid (HA), dermatan sulfate (DS), heparan sulfate (HS), and keratan sul- fate (KS), which modulate adhesion, migration, and cell prolifera-tion processes.10-12

The sulfated glycosaminoglycan include chondroitin sul-fate (CS), DS, KS, heparin (HEP), and HS, while the hyaluronic acid represents a non-sulfate GAG class.13 The GAG can interact with

distinct proteins, including chemokines, cytokines, growth factors, enzymes, and adhesion molecules, promoting the regulation of diverse biological functions.10-14

Proteoglycans are macromolecules made up of a protein skeleton linked to GAG strains. Proteoglycans are present on the cell’s surface, intracellular granules, and the extracellular matrix, which can regulate cytokines, angiogenic factors, and growth fac-tors. The effects of proteoglycans in various cell mechanisms in general are modulated by interactions with GAG strains or by inter-actions with the protein skeleton. Proteoglycans play an important role in the organization of collagen fibers and participate in biolog- ical phenomena, such as differentiation, maintenance, and organi-zation of the extracellular matrix.15 HS proteoglycans are essential

components of the extracellular matrix and basal membrane, responsible for the integrity of the membrane and the barrier function.16,17 HPSE has the capacity to cleave proteoglycan strains,

facilitating invasion and metastasis of the tumor cells, generating oligossacharides that increase the activity of angiogenic factors, cytokines, and growth factors, thus inducing cell proliferation, migration and inflammatory responses.18,19 The composition of the

extracellular matrix is associated with the infiltration of metastatic tumor cells and inflammatory cells. 20

The present study sought to compare the profile of GAGs and the mRNA expression of the HPSE enzyme in SCC cell strains (A431) and non-neoplasic strains (HaCaT), as well as investigate the HPSE expression in BCC and SCC samples from surgical resections in order to compare the results between such groups and control tissues from skin obtained from plastic surgery, by means of Bleph- aroplasty, analyzing possible correlations between the HPSE expres-sion and the occurrence of BCC and SCC.

METHODS Patients

This study analyzed 30 patient skin tissue samples, with no restrictions as to race, age, or gender. To evaluate the mRN expres- sion of HPSE, the quantitative RT-PCR (qRT-PCR) method was ap-plied. The samples were obtained from the Surgery Ward of the Der-matology Department of the ABC Medical School, retrieved from

dermatological surgeries that had been previously recommended by this institution’s outpatient service. The samples were divided into three groups, 10 samples of SCC, 10 samples of BCC, and 10 samples of non-neoplasic skin tissue received from blepharoplasty plastic surgery, which were used as the control tissues (CTR). The collection of tissue samples were performed using a 2 mm punch and all samples in this study were stored in liquid nitrogen for pro-cessing. The procedures described in this study were approved by the Research Ethics Committee from the ABC Medical School, regis-tered under protocol number 041/2011.

Cell strains This study used cell strains from human keratinocytes (Ha-CaT) and human SCC cells (A431). The strains defined as HaCaT and A431 were cultivated in a DMEM sterile culture medium, con-taining 10% bovine fetal serum (FBS) and antibiotics (100 µg/mL of streptmicin and 100 Ul/mL of penicillin). Enzymatic degradation The defining of galactosaminoglycans (CS and DS) was ob- tained after enzymatic degradation with specific lyasis; chondrioti- nase AC, which specifically degrades chondroitin sulfate; and chon-droitinase ABS, which degrades CS and DS. The identification of the GAGs that have been synthesized and secreted into the culture me-dium was conducted by means of electrophoresis in a 0.55% agarose gel in a 1,3-diaminopropane acetate (PDA), 0.05M, pH 9.0, 100 Volts, for one hour, in a cooler at 4ºC (Dietrich 1976). After electrophoresis had been performed, the GAGs were precipitated in agarose gel in a 0.1% cetyltrymethylammonium solution (Cetavlon) for 2 hours. The gel was dried under ventilation and heat, and was later stained with a 0.1% toluidine blue stain in 1% acetic acid and 50% ethanol. The excess stain was removed by rinsing with a bleaching solution (1% acetic acid, 50% ethanol). The stained gel, dried at room tempera-ture, was submitted to radioautography by exposure to an X-ray. The sensibilized film was then submitted to scanning in a Cyclone™ device (Packard Instrument Company, Meriden, CT, USA), showing the S-GAGs35 by scintillations per minute (spm)

HA dose

The fluorimetric method was applied to determine the HA described by Martins et al.21 The quantification of HA from each

sample was determined in values expressed by the µg of HA / µg of total proteins.

mRNA extraction, cDNA synthesis, and HPSE expression

The skin samples were submitted to mRNA extraction us-ing the RNAspin kit (GE Healthcare®), following manufacturer

instructions. The reverse transcription was performed by applying the protocol described by the manufacturer as of 5µg of total RNA. The mixture was incubated at 70ºC, for 10 minutes. Next, 4 µL of 5X buffer solution, 2 µl of dithiothreitol 0.1 mM of Promega®, 1 µl of deoxynucleotide triphosphate, 10 mM of Promega®, and 1 µL of reverse transcriptase enzyme (Promega®) was added to the mixture. This solution was incubated for 10 minutes at 25ºC, 50 minutes at 42ºC, and 10 minutes at 70°C to obtain the cDNA.

(3)

qRT- PCR

The qRT-PCR method allows for the definition of the rela-tive mRNA expression of HSPE, which was achieved by using the sense oligonucleotide primer 5’ TGGCAAGAAGGTCTGGTTAG-GAGA 3’ and antisense oligonucleotide primer 5’ GCAAAGGT-GTCGGATAGCAAGG 3’. The amplification was performed using the SYBR® Green PCR Master Mix Reagent (Applied Biosystems,

Carlsbad, California, USA), according to the following modified protocol: 1.5 µL of forward primer at 1.5 µM, 1.5 µL of reverse primer at 1.5 µM, 3 µL of cDNA 1:10, and 6 µL of SYBR® Green Master Mix

2X. The mRNA expression of HSPE was presented in relation to the geometric average of the endogenous constitutive gene expression (-ΔCt): ribosomal protein 18S L13A (RPL13a), sense oligonucleotide primer 5´TTGAGGACCTCT GTGTATTTGTCAA3´, antisense oli-gonucleotide primer 5´CCTGGAGGAGAAGAGGAAAGAGA3´, and the enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH), sense oligonucleotide primer 5´TCGACAGTCAGC-CGCATCTTCTTT3´ and antisense oligonucleotide primer 5´GC-CCAATACGACCAAAT CCGTTGA3´. All of the trials were con-ducted in triplicate. The ABI PRISM 7000 SDS technological platform was used under the following thermocycling conditions: 95ºC for 10 minutes, 45 cycles at 95ºC for 30 seconds and at 60ºC for 1 minute, resulting in an approximate reaction time of 2 hours.

Statistical Analysis

The statistical analysis was performed using the Prism5 program for Windows (GraphPad Prism® Software Inc., CA, USA).

All variables were considered to be non-parametric, in accordance

with the Kolmogorov-Smirnov test. When comparing the two groups, the Mann-Whitney test was applied, and to compare more than two groups, the Kruskal Wallis test was applied, followed by the Dunn post-hoc test. For the analyses, the quantitative variables were described by average and standard deviation, while the signif-icance level was set as p <0.05.

RESULTS

This study began by investigating the presence of sulfated GAG, by electrophoresis, in HaCaT and A431 cell strains. According to that illustrated in graph 1, we observed that the HaCaT and A431 cells presented a compound of electrophoretic migration that resem-bled CS/DS and another band corresponding to HS.

The definition of the type of CS and/or DS was determined after enzymatic degradation with specific lyasis, chondroitase AC, and chondroitase ABC, as presented in graph 2. The analysis of the enzymatic digestion with chrondroitase illustrated the presence of DS, which had been synthesized and secreted into a culture medium of both cell strains, HaCaT and A431 (Graph 2). Graph 3 shows the results obtained from the quantification of DS and HS, synthesized by the HaCaT and A431 cell strains. As observed in graph 3, the HS expression was significantly greater in the A431 cells, when compared to the HaCaT cells, re-spectively: 119030 ± 20775 cpm / µg total protein and 21731.25 ± 831.25 cpm / µg total protein, for the cell fraction (p = 0.0022, non-paired t test) and 94835 ± 18669 cpm / µg total protein 2787 ±50 cpm / µg total protein, for the HS secreted into the medium (p < 0.0001, non-paired t test). The DS values also presented significant

graph 1:

Profile of glycosaminoglycan sulfate synthesized by HaCaT and A431

Cell fraction Culture medium Cell fraction Culture medium

This trial shows the radioautography of elec-trophoresis conducted to identify and quan-tify the glycosaminoglycan (GAG) sulfates in the HaCat and A431 strains. HS, heparan sulfate; CS/DS, chondroitin sulfate and der-matan sulfate This figure illustrates the presence of synthesized and secreted DS in both cell strains. The cells were marked with [35S]-sulfate. The extract obtained from the cell fraction (cells and extracellular matrix) and conditioned medium were submitted to degradation with chondroitinase AC and ABC, 1, samples not submitted to enzymatic degradation; 2, samples digested with chondroitinase AC, and 3, samples digested with chondroitinase ABC. HS, heparan sulfate and DS, dermatan sulfate graph 2:

Radioautography of electrophoresis after the enzymatic degradation of the GAG sulfates synthesized by HaCaT and A431 cells

(4)

differences when comparing both the A431 and HaCaT cells, respectively: 15602 ± 6134 versus 6362 ±137 in the cell fraction (p = 0.0007, non-paired t test) and 13219 ± 2418,87 versus 1011 ± 50.00 versus for the DS secreted into the medium (p = 0.0013, non-paired t test). Therefore, it is clear that the tumor cells (A431) synthesize and secrete larger quantities of HS and DS when compared to the HaCaT non-neoplasic cells, as shown in graph 3.

The quantification of the non-sulfate GAG, HA, was also defined in the HaCaT and A431 cell strains (Graph 4). Graph 4 presents evidence of the significantly larger quan-tity of HA in the cell fraction of the HaCaT strain when compared to the A431 strain, respectively (196.1 ± 12.7 ng / µg total protein) versus (56.0 ± 4.3 ng / µg total protein) (p= 0.0308, non-paired t test). However, no difference in the quantity of HA secreted into the cul-ture medium, when compared to HaCaT, was observed (306.2 ± 52.3 ng / µg total protein) versus A431 (218.4 ± 55 ng / µg total protein). The mRNA expression of HSPE, from the HaCaT and A431 strains is presented in graph 5 and shows the increase in relative ex-pression of HPSE in A431 tumor cells, 0.00897 ± 0.00103, as compared to the HaCaT non-neoplasic strain, 0.00199 ± 0.00028, (p = 0.0048).

Taking into account the results obtained in the analyses of both human skin cell strains (HaCaT and A431), we decided to investigate the expression of the HPSE enzyme in BCC and SCC samples, in comparison with skin from the eyelids of individuals who had not been diagnosed with any type of neoplasia (blepha-roplasty). Graph 6 illustrates that SCC and BCC, as compared to the blepharoplasty samples, presented an increased mRNA expression of the HPSE enzyme,. A significant difference was observed between the mRNA of the HPSE when compared to the control and SCC sam-ples, respectively: (0.01827 ± 0.02204) and (0.2251 ± 0.2921), applying the Mann-Whitney test with a p<0.0001. In addition, the heparanase mRNA was also significantly higher in SCC (0.2251 ± 0.2921), as compared to BCC (0.03881 ± 0.06836), p = 0.0002. Nonetheless, a statistically significant difference between the control samples and patient tissues as regards SCC was identified (p=0.0024).

HS, heparan sulfate; DS, Dermatan sulfate. Cell fractions, quantification of GAGs synthesized by cells and the extracellular matrix (*P = 0.0022 and **P = 0.0007, non-paired t test). Medium, GAGs secreted into the culture medium (*P < 0.0001 and **P = 0.0013, non-paired t test)

HA, Hyaluronic acid. Cell fraction, quantifica- tion of HA synthesized by cells and the extra-cellular matrix; Medium, HA secreted into the culture medium. (*P = 0.0308, non-paired t test).

mRNA expression of HPSE obtained from qRT-PCR, as described in the Methods section. The values represent the relative expression of HPSE, using endogenous genes as the control (GAPDH, glyceraldehyde-3-phosphate-de-hydrogenase, and RPL13a, ribosomal protein). HaCat, non-neoplasic human skin cell strain, and A431, human SCC neoplasic cell strain. The values rep-resent the average and standard deviation of trials performed in triplicate. * P = 0.0048

graph 3:

Quantification of GAG sulfates in HaCaT and A431cells

graph 4:

Quantification of hyaluronic acid (HA) synthesized by HaCaT and A431 cells graph 5: H e p a r a n a s e Expression in different cell strains Cell fraction Cell fraction

Relative Expression HPSE

total protein total protein total protein total protein Medium Medium

(5)

DISCUSSION

The GAG sulfates play an important role in cell signaling and in the remodeling of the extracellular matrix. According to the cell type, there is a broad structural variability of GAG sulfates. Changes in the profile of GAG sulfates are related to the develop- ment of many illnesses, such as cancer, inflammatory diseases, de-generative diseases, as well as healing processes.22-25 The study of

extracellular components, such as proteoglycans, fibrous proteins, glycoproteins, metalloproteases, and glycosidases, can shed light on the molecular changes directly related to the development of such diseases.16,24,26

The results found in the present study characterize the pro- file of GAG sulfates in HaCaT and A431 cell strains, and demon-strate the increase in HS and DS expressions in cell strains from SCC, as compared to those from keratinocytes, corroborating with data from prior literature, which show changes in such compounds during the development of cancer.

Curiously enough, prior literature has reported that the re-duction of HA in biopsy samples from patients diagnosed with SCC is directly related to an unfavorable diagnosis of the disease, in turn suggesting that the reduction of HA immunomarkers presents a di-rect correlation with patients’ lower survival rate.27 The reduction in the quantity of HA from cell fractions in A431 cells, when compared to HaCaT non-neoplasic cells, corrobo-rates with the hypothesis that tumor cells with a lower cell differen-tiation present a lower quantity of HA.

HPSE is an endo-β-glucuronidase capable of cleaving HS strains of proteoglycans. The oligossacharides generated by the ac-tion of HPSE interact with greater affinity towards growth factors, angiogenic factors, and cytokines, thus intensifying the action of such molecules involved in cell processes, such as the development of tumors, proliferation, migration, cell invasion, and inflammatory response.

Tumor progression involves the degradation of extracellu-lar matrix components, which clearly require the action of proteases and glycosidases.28 The silencing of HPSE, using interference RNA

(siRNA), demonstrated a significant reduction in the process of tumor metastasis and angiogenesis, indicating that such an enzyme is essential in the progress of molecular mechanisms of cancer development. Therefore, HPSE has become a potential target for antitumor therapy. 29

Many reports in the literature prove that high levels of HPSE expression in mammal cells seem to be associated with the development of tumors and metastasis.30,31

The results obtained in the present study provide evidence that the levels of mRNA from the HPSE enzyme are increased in SCC, as compared to BCC, while non-neoplasic skin suggest a pos- sible correlation of HPSE expression with skin cancer, which corrob-orates with that reported in prior literature.18

Treatment with HPSE inhibitors significantly reduces the incidence of tumor metastasis in trials that use the animal model, presenting high levels in advanced stages of the disease.32,33

The present study also found an expressive HPSE increase in BCC and SCC tumors, when compared to non-neoplasic tissues. These results demonstrate that the mRNA expression of the HPSE enzyme is significantly higher in nonmelanoma skin cancer. Such results contributed to the findings relative to HPSE expression in the A431 strain, which represents a cell strain formed in SCC. According to the literature, the main cause of nonmelano-ma skin cancer is one’s exposure to ultraviolet radiation. IriyaAccording to the literature, the main cause of nonmelano-ma

et al. reported that chronic exposure to UVB radiation activates the HPSE expression, in turn leading to the cleavage of the basal membrane’s HS, resulting in changes in the epidermis and dermis of the skin that has been exposed to acute and chronic UVB radia-tion.9 Kurdykowski et al. reported that mRNA expression and the

enzymatic activity of HPSE were augmented depending on the dose of radiation used in studies with human keratinocyte cell cultures.34

The significant increase in HS in the A431 tumor strain may well suggest that such a compound can induce HPSE expression, since HS is a substrate of this enzyme, which will trigger the remod-eling of the extracellular matrix in tumor tissues and will participate in carcinogenesis.

Prior literature defends that HPSE is involved in tumor an- giogenesis and metastasis, suggesting that this enzyme is a promis-ing target for the development of new therapies against nonmela-noma skin cancer.35

CONCLUSION

A significant difference can be observed between HPSE expression and the profile of GAGs when we analyze non-neopla-sic human cell strains (HaCaT) and SCC strains (A431). The A431 graph 6: Relative mRNA expression of HPSE. The results were ob- tained by analysis using qRT-PCR, as described in the Methods sec- tion. CTR, samples collected from patients that presented no neo-plasias (Control); BCC, sample of basal cell carcinoma; and SCC, samples from squamous cell carcinoma. The relative expression of HPSE was obtained using the endogenous genes GAPDH and RPL13a. The strains represent the average of the values of HPSE expression in each group. The values were collected through trials performed in triplicate. CTR versus BCC *P=0.0024; CTR versus SCC **P<0.0001, and BCC versus SCC ***P = 0.0002 (non-paired t test)

(6)

REFERENCES

1. Inca.gov.br [Internet]. Tipos de Câncer. Pele não melanoma [acesso 21 Jul 2015] Disponível em: http://www.inca.gov.br/estimativa/2014/sintese-de-resultados-comentarios.asp.

2. Souza RJ, Mattedi AP, Corrêa MP, Rezende ML, Ferreira AC. Estimativa do custo do tratamento do câncer de pele tipo não-melanoma no Estado de São Paulo - Brasil. An Bras Dermatol. 2011;86:657-62.

3. Sampaio APS, Rivitti EA. Dermatologia. 3. ed. São Paulo: Artes Médicas; 2008. 4. Mantese SAO, Berbert ALCV, Gomides MDA, Rocha A. Carcinoma basocelular:

Análise de 300 casos observados em Uberlândia MG. An Bras Dermatol. 2006;81:136-42.

5. Martinez MAR, Francisco G, Cabral LS, Ruiz IRG, Festa Neto C. Genética molecular aplicada ao câncer cutâneo não melanoma. An Bras Dermatol. 2006;81:405-19. 6. Favalli P, Bergonsi TO, Pavanello DP, Orsi V, Pase P, Schimidt M, et al. Carcinoma

epidermóide de pele: Cutaneous epidermoid carcinoma. Revista da AMRIGS. 2007;51:301-5.

7. Wong CS, Strange RC, Lear JT. Basal cell carcinoma. BMJ. 2003;327:794-8. 8. Alam M, Ratner D. Cutaneous squamous-cell carcinoma. N Engl J Med.

2001;344:975-83.

9. Iriyama S, Matsunaga Y, Takahashi K, Matsuzaki K, Kumagai N, Amano S. Activation of heparanase by ultraviolet B irradiation leads to functional loss of basement membrane at the dermal-epidermal junction in human skin. Arch Dermatol Res. 2011;303:253-61.

10. Gallo R. Proteoglycans and cutaneous vascular defense and repair. J Investig Dermatol Symp Proc. 2000;5:55-60.

11. Malmström A, Bartolini B, Thelin MA, Pacheco B, Maccarana M. Iduronic acid in chondroitin/dermatan sulfate: biosynthesis and biological function. J Histochem Cytochem. 2012;60:916-25.

12. Zhao X, Yang B, Solakyildirim K, Joo EJ, Toida T, Higashi K, et.al. Sequence analysis and domain motifs in the porcine skin decorin glycosaminoglycan chain. J Biol Chem. 2013;288:9226-37.

13. Jeanloz RW. The nomenclature of mucopolysaccharides. Arthritis Rheum. 1960;3:233-7.

14. Gandhi NS1, Mancera RL. The structure of glycosaminoglycans and their interactions with proteins. Chem Biol Drug Des. 2008;72:455-82.

15. Schönherr E, Hausser HJ. Extracellular matrix and cytokines: a functional unit. Dev Immunol. 2000;7(2-4):89-101.

16. Theodoro TR, de Matos LL, Sant Anna AV, Fonseca FL, Semedo P, Martins LC, et. al. Heparanase expression in Circulating Lymphocytes of Breast Cancer Patients Depends on the Presence of the Primary Tumor and/or Systemic Metastasis. Neoplasia. 2007;9:504-10.

17. Edovitsky E, Lerner I, Zcharia E, Peretz T, Vlodavsky I, Elkin M. Role of endothelial heparanase in delayed-type hypersensitivity. Blood. 2006;107:3609-16. 18. Vlodavsky I, Friedmann Y. Molecular properties and involvement of heparanase in

cancer metastasis and angiogenesis. J Clin Invest. 2001;108:341-7.

19. Jiang G, Zheng L, Pu J, Mei H, Zhao J, Huang K, et al. Small RNAs targeting Transcription Start Site Induce Heparanase Silencing through Interference with Transcription Initiation in Human Cancer Cells. PLoS One. 2012;7:e31379. 20. Komatsu N, Waki M, Sue M, Tokuda C, Kasaoka T, Nakajima M, et al. Heparanase

expression in B16 melanoma cells and peripheral blood neutrophils before and after extravasation detected by novel anti-mouse heparanase monoclonal antibodies. J Immunol Methods. 2008;331:82-93.

21. Martins JR, Passerotti CC, Maciel RM, Sampaio LO, Dietrich CP, Nader HB. Practical determination of hyaluronan by a new noncompetitive fluorescence-based assay on serum of normal and cirrhotic patients. Anal Biochem. 2003;319:65-72.

M

ailing

address

:

Maria Aparecida Silva Pinhal

Avenida Príncipe de Gales, 821

Santo André - SP

09060-650

Brazil

E-mail: [email protected]

How to cite this article:

Pinhal MAS, Almeida MCL, Costa AS, Theodoro TR, Serrano RL, Machado Filho CDS.

Expression of heparanase in basal cell carcinoma and squamous cell carcinoma. An Bras Dermatol. 2016;91(5):595-600.

22. Kozlowski EO, Pavao MS, Borsig L. Ascidian dermatan sulfates attenuate metastasis, inflammation and thrombosis by inhibition of P-selectin. J Thromb Haemost. 2011;9:1807-15.

23. Taylor KR, Rudisill JA, Gallo RL. Structural and sequence motifs in dermatan sulfate for promoting fibroblast growth factor-2 (FGF-2) and FGF-7 activity. J Biol Chem. 2005;280:5300-6.

24. Pecchi E, Priam S, Mladenovic Z, Gosset M, Saurel AS, Aguilar L, et.al. A potential role of chondroitin sulfate on bone in osteoarthritis: inhibition of prostaglandin E2

and matrix metalloproteinases synthesis in interleukin-1β-stimulated osteoblasts. Osteoarthritis Cartilage. 2012;20:127-35.

25. Batista LT, Matos LL, Machado LR, Suarez ER, Theodoro TR, Martins JR, et.al. Heparanase expression and glycosaminoglycans profile in renal cell carcinoma. Int J Urol. 2012;19:1036-40.

26. Moscatello DK, Santra M, Mann DM, McQuillan DJ, Wong AJ, Iozzo RV. Decorin suppresses tumor cell growth by activating the epidermal growth factor receptor. J Clin Invest. 1998;101:406-12.

27. Kosunen A, Ropponen K, Kellokoski J, Pukkila M, Virtaniemi J, Valtonen H, et.al. Reduced expression of hyaluronan is a strong indicator of poor survival in oral squamous cell carcinoma. Oral Oncol. 2004;40:257-63.

28. Vlodavsky I, Korner G, Ishai-Michaeli R, Bashkin P, Bar-Shavit R, Fuks Z. Extracellular matrix-resident growth factors and enzymes: possible involvement in tumor metastasis and angiogenesis, in Cancer Metastasis. Cancer Metastasis Rev. 1990;9:203-26.

29. Edovitsky E, Elkin M, Zcharia E, Peretz T, Vlodavsky I. Heparanase gene silencing, tumor invasiveness, angiogenesis, and metastasis. J Natl Cancer Inst. 2004;96:1219-30.

30. Hulett MD, Freeman C, Hamdorf BJ, Baker RT, Harris MJ, Parish CR. Cloning of mammalian heparanase, an important enzyme in tumor invasion and metastasis. Nat Med. 1999;5:803-9.

31. Lerner I, Baraz L, Pikarsky E, Meirovitz A, Edovitsky E, Peretz T, et.al. Function of heparanase in prostate tumorigenesis: potential for therapy. Clin Cancer Res. 2008;14:668-76.

32. Li JP. Heparin, heparan sulfate and heparanase in cancer: remedy for metastasis? Anticancer Agents Med Chem. 2008;8:64-76.

33. Chen Y, Chen Y, Huang L, Yu J. Evaluation of heparanase and matrix metalloproteinase-9 in patients with cutaneous malignant melanoma. J Dermatol. 2012;39:339-43.

34. Kurdykowski S, Mine S, Bardey V, Danoux L, Jeanmaire C, Pauly G, et al. Ultraviolet-B irradiation induces epidermal up-regulation of heparanase expression and activity. J Photochem Photobiol B. 2012;106:107-12.

35. Elkin M, Ilan N, Ishai-Michaeli R, Friedmann Y, Papo O, Pecker I, et al. Heparanase as mediator of angiogenesis mode of action. FASEB J. 2001;15:1661-3.

strain, as compared to the HaCaT strain, presents a significant in-crease in HPSE expression. It can therefore be hypothesized that the increase in HPSE expression in the A431 strain may well be related to the increase in this strain’s HS. BCC and SCC samples present an increase in the mRNA ex-pression of the HPSE enzyme, as compared to skin that has not been

affected by such types of nonmelanoma cancer. Such results suggest that the HPSE is possibly linked to cell mechanisms involved in the development of BCC and SCC.

Future studies are warranted to elucidate the mechanisms of cell signaling involved in the increase of the HPSE enzyme ex-pression in the development of BCC and SCC. q

Referências

Documentos relacionados

Este ponto definido para os BRT estaria instalado no lugar adequado conforme a demanda máxima adotada, onde pode-se observar no gráfico que a queda de tensão está próxima da

Freundlich sorption isotherms (solid symbol) and sequential desorption steps (open symbols) for atrazine in soils subjected to different fertilizations (MIN, mineral fertilizer;

The purpose of the present study was to analyze the clinical response of cryosurgery for the treatment of squamous cell carcinoma in cats.. For this 13 squamous cell carcinoma

The atypical expression of GLUTs in oral squamous cell carcinoma does not necessarily signify an increase in the rate of glucose transport to the tumor cell, in order to promote

C ONSIDERANDO O MESMO TRECHO DE CÓDIGO ACIMA E USANDO RECURSÃO ESCREVA UM MÉTODO QUE VERIFICA SE UMA LISTA É IGUAL A OUTRA PASSADA COMO PARÂMETRO... MÉTODO QUE VERIFICA SE UMA LISTA

Objectives: To evaluate the expression of the vascular endothelial growth factor marker in non-glottic advanced squamous cell carcinoma of the larynx (T3/T4) and correlate it with

[...] experiências educativas que interajam com a realidade de cada cultura; – ensino contextualizado com os diferentes universos musicais da vida cotidiana; – práticas

Uma maquete foi desenvolvida para simular a calha de uma residência e, acoplado à calha, está o sensor de fluxo, como pode ser visualizado na figura 1.. A cisterna