Universidade Estadual de Campinas
Faculdade de Odontologia de Piracicaba
Bruno Dias Nani
Relação entre níveis bacterianos e produção de compostos
sulfurados voláteis em voluntários saudáveis com estresse
acadêmico
Relationship between bacterial counts and volatile sulphur
compounds production in healthy volunteers with academic
stress
PIRACICABA
2016
Bruno Dias Nani
Relação entre níveis bacterianos e produção de compostos
sulfurados voláteis em voluntários saudáveis com estresse
acadêmico
Relationship between bacterial counts and volatile sulphur
compounds production in healthy volunteers with academic
stress
Dissertação apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Mestre em Odontologia, na Área de Farmacologia, Anestesiologia e Terapêutica.
Dissertation presented to the Piracicaba Dental School of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Dentistry in Pharmacology, Anesthesiology and Therapeutics Area.
Orientadora: Profa. Dra. Michelle Franz Montan Braga Leite
Co-orientadoras: Profas Dras. Karina Cogo Müller e Fernanda Klein Marcondes
ESTE EXEMPLAR CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELO ALUNO BRUNO DIAS NANI E ORIENTADA PELA PROFA. DRA. MICHELLE FRANZ MONTAN BRAGA LEITE.
PIRACICABA
2016
Dedicatória
Dedico esta dissertação ao meu filho João que tanto amo, que transformou minha vida e é minha maior fonte de inspiração. Também dedico a minha mãe, que sempre me apoiou e que sinto tanta falta.
Agradecimentos
À Universidade Estadual de Campinas, por meio do reitor Prof. Dr. José Tadeu Jorge.
À Faculdade de Odontologia de Piracicaba (FOP-UNICAMP), na pessoa do diretor Prof. Dr. Guilherme Elias Pessanha Henriques
À coordenadora dos Cursos de Pós-Graduação da Faculdade de Odontologia de Piracicaba, Profª. Dra. Cínthia Pereira Machado Tabchoury.
À Profa. Dra. Juliana Trindade Clemente Napimoga, coordenadora do Curso de Pós–Graduação em Odontologia.
Ao Prof. Dr. Francisco Carlos Groppo, chefe do departamento de Ciências Fisiológicas da Faculdade de Odontologia de Piracicaba.
À FAPESP, Fundação de Amparo à Pesquisa do Estado de São Paulo, pela bolsa de estudo concedida (2013/26691-0) e pelo apoio financeiro (2011/50419-2) para a realização deste trabalho.
À Sra. Érica Alessandra Sinhoreti, à Sra. Ana Paula Carone e à Sra. Raquel Quintana Sachi, membros da Coordenadoria do Programa de Pós-Graduação da FOP-UNICAMP, pela solicitude e presteza de seus serviços.
Agradecimentos Especiais
À Paula, que sempre esteve ao meu lado e foi fundamental para concretização deste sonho.
Aos meus pais José Geraldo, Maria Aparecida, sogros Gilberto e Eliane Aguiar, irmã Daíla e cunhado Enzo, pelo apoio e carinho.
Às Profas. Dras. Michelle Franz Montan Braga Leite, Karina Cogo Müller e Fernanda Klein Marcondes, às quais agradeço pela orientação e amizade. Me espelho em vocês como profissionais competentes e humanos.
À Profa. Dra. Patricia Oliveira de Lima, pela amizade e parceria, muito obrigado.
Ao Prof. Dr. Francisco Carlos Groppo, por ter me recebido como aluno de iniciação científica e pela preciosa assessoria estatística para a realização deste trabalho.
Aos amigos Ana Paula, Lívia, Marcelo, Bruna, Luiz, Bigode, Irlan, Luciano, Cleiton, Camila, Sérgio, Josy, Lucia, Jonny, Janaína e Aline. Vocês fazem da FOP-UNICAMP um lugar especial, obrigado pela companhia e amizade.
Aos técnicos dos laboratórios de Fitoquímica do CPQBA (Adilson Sartoratto) e da Farmacologia (Eliane e José Carlos) e secretárias (Elisa e Eliete) da FOP/UNICAMP pela simpatia, amizade e por toda a ajuda oferecida.
Ao prof. Dr. Antonio Bento de Moraes e sua equipe (Dras. Renata Sá, Karen Mendes e Dr. Gustavo Rolim), do departamento de psicologia da FOP, que me auxiliaram na interpretação dos resultados dos questionários MBI-SS.
Resumo
Já se sabe que o estresse acadêmico é capaz de aumentar a emanação oral de Compostos Sulfurados Voláteis (CSV), os gases que causam a halitose. Também comprovou-se que a saliva destes indivíduos apresenta aumento nas concentrações de Alfa-amilase (AA), Mucina 5b (MUC) e diminuição na concentração de Beta-defensina (BD). Estes achados indicam que a cavidade oral destes indivíduos é um ambiente favorável para a produção bacteriana de CSV, mas isto ainda não foi confirmado. Assim, os objetivos deste trabalho foram avaliar a relação entre a quantidade salivar de bactérias associadas a halitose, a emanação oral de CSV e o estresse acadêmico em indivíduos saudáveis, bem como se AA, a BD e a MUC alteram o crescimento destas bactérias in vitro. 78 estudantes homens foram avaliados em um estudo prévio quanto à presença de estresse acadêmico por meio da determinação da síndrome de burnout e quanto à emanação oral dos CSV H2S, CH3SH e (CH3)2S por meio do Oral Chroma™. No presente estudo, estas amostras de saliva foram agrupadas nos grupos “Com Estresse” (“S”) e “Sem Estresse” (“NS”) e foram quantificadas as bactérias totais e sete bactérias relacionadas com a halitose por qPCR. Os dados obtidos foram comparados entres os grupos e correlacionados com a emanação oral de CSV pelos voluntários do estudo anterior. Duas bactérias foram selecionadas para uma avaliação in vitro de seu crescimento na presença de AA, BD e MUC. Nossos resultados mostraram que 21 voluntários eram estressados (grupo “S”) e 57 não eram (grupo “NS”). O grupo “S” apresentou quantidades aumentadas de H2S, (CH3)2S e Solobacterium moorei (Sm) (p < 0.05, Mann Whitney). Quando considerados apenas os voluntários do grupo “S”, houve correlação positiva e moderada entre Fusobacterium nucleatum (Fn) e H2S; Fn e CH3SH; Sm e CH3SH; Sm e Fn; Tannerella forsythia (Tf) e Sm; e Tf e Fn (p < 0.05, Correlação de Spearman). AA, BD e MUC não alteraram o crescimento in vitro de Sm e Fn (p > 0.05, one way ANOVA). Desta forma, concluímos que o aumento da emanação oral de H2S relacionou-se com o aumento na quantidade salivar de Sm e de sua interação com Fn e Tf, indicando que estas bactérias são importantes para o desenvolvimento da halitose decorrente de alterações emocionais. Permanecem desconhecidos os mecanismos responsáveis pelo aumento na emanação oral de (CH3)2S.
Palavras-chave: Halitose. Esgotamento profissional. Solobacterium moorei.
Abstract
Recently it was demonstrated that academic stress is able to increase emanation of oral Volatile Sulphur Compounds (VSC), the gases that cause halitosis. These subjects also showed an increased salivary concentration of Alpha-amylase (AA) and Mucin 5b (MUC) and a decreased concentration of Beta-defensin (BD). These findings indicate that altered saliva represents a favorable environment for bacterial VSC production in oral cavity, but this has not been confirmed yet. The aims of this study were to evaluate the relationship between salivary bacterial amount, oral emanation of VSC and academic stress in healthy subjects, and if AA, BD and MUC are able to alter bacterial viability in vitro. In a previous study, 78 men students were evaluated for the presence of stress by quantifying the burnout syndrome and oral emanation of the VSC H2S, CH3SH and (CH3)2S by Oral Chroma™. In the present study, these salivary samples were grouped in either "Stress" ("S") or "No Stress" ("NS") groups. Total bacterial counts and seven halitosis-related bacteria were quantified by qPCR. Data were compared between groups and correlated with VSC emanation by previous study subjects. Two bacteria were selected for an in vitro evaluation of its growth in presence of alpha-amylase (AA), beta-defensin (BD) and mucin (MUC). According to burnout syndrome quantification, 21 subjects were classified in “Stress" group and 57 in "No Stress" group. "S" group showed increased amounts of H2S, (CH3)2S and
Solobacterium moorei (Sm) (p < 0.05, Mann Whitney). Considering only "S" group
volunteers, there was a moderate positive correlation between Fusobacterium
nucleatum (Fn) and H2S, Fn and CH3SH; Sm and CH3SH; Sm and Fn; Tannerella
forsythia (Tf) and Sm; Tf and Fn (p < 0.05, Spearman correlation). AA, BD and MUC
did not alter the in vitro growth of Sm and Fn (p> 0.05, one way ANOVA). These results indicate that increased oral emanation of H2S was related to the increase in Sm salivary amount and its interaction with Fn and Tf, indicating that these bacteria are important for the development of halitosis due to emotional disorders. It remains unknown the mechanisms responsible for the increase in oral emanation (CH3)2S.
Key words: Halitosis. Burnout. Solobacterium moorei. Fusobacterium nucleatum.
Sumário
1 INTRODUÇÃO... 11 2 ARTIGO... 16 3 CONCLUSÃO... 44 REFERÊNCIAS... 45 ANEXOS... 49Anexo 1 - “Maslach Burnout Inventory Student Survey” questionnaire……. 49
Anexo 2 - Certificado do Comitê de Ética em Pesquisa... 50
Anexo 3 - Comprovante de submissão ao periódico Stress... 51
Anexo 4 - Certificado apresentação de painel FESBE... 52
1 INTRODUÇÃO
O corpo humano pode emitir uma grande variedade de moléculas voláteis e diversos fatores podem ter influência direta nessa produção, como genética, dieta e condições patogênicas (Scully e Greenman, 2012). A cavidade oral e nasal emitem estes odores de forma fisiológica, mas a partir do momento em que o odor é percebido pelo próprio indivíduo ou por outras pessoas, caracteriza-se a patologia chamada de halitose, que também pode ser chamada de mau odor ou mau hálito (Yaegaki e Coil, 2000). Esta é uma condição que pode ser considerada preocupante, pois causa grande desconforto e constrangimento pessoal (Bosy, 1997).
Devido a sua complexidade, Aydin e Harvey-Woodworth (2014) propuseram uma nova forma de classificar a halitose, concordando com a definição apresentada acima, mas acrescentando que o mau odor emitido da cavidade oral e/ou nasal pode ser originado em diferentes regiões do organismo e que a halitose objetiva, aquela em que o mau odor é confirmado por outras pessoas, pode ser uma resultante dos compostos odoríferos produzidos em mais de uma região ao mesmo tempo. Além disso, estes autores classificam as origens destes gases em seis tipos de halitose diferentes, que serão apresentados a seguir.
O tipo zero de halitose é a halitose fisiológica, ou seja, a emanação de moléculas voláteis de forma comum e transitória, estes gases podem ser originados na cavidade oral, trato respiratório, trato digestivo e sangue (Aydin e Harvey-Woodworth, 2014). Segundo estes autores, cada tipo de halitose tem um caráter fisiológico, mas não é detectado pelo indivíduo e pelas pessoas ao seu redor ou é detectado somente em momentos restritos e não de forma crônica.
A halitose de origem oral é classificada como do tipo 1, a mais comum de todas (Aydin e Harvey-Woodworth, 2014), sendo relatada como a origem de 76 (Quirynen et al., 2009) a 96,2% (Zürcher e Filippi, 2012) dos casos de halitose. É decorrente da atividade bacteriana, principalmente de anaeróbicos Gram-negativos (Kurata et al., 2008) e as causas mais comuns são língua saburrosa (46%), periodontite (7%), gengivite (4%) e xerostomia (3%), existindo ainda a associação entre periodontite ou gengivite com língua saburrosa, responsável por 18% dos casos (Quirynen et al., 2009).
Na halitose oral, bactérias degradam um substrato proteico que contém enxofre, como cistina, cisteína e metionina, e produzem compostos sulfurados voláteis (CSV), que são produtos gasosos sulfurados responsáveis pelo odor desagradável e característico da halitose na grande maioria dos casos (Persson et al., 1990). Dentro desse grupo fazem parte o sulfeto de hidrogênio (H2S), a metilmercaptana (CH3SH) e o dimetilsulfeto [(CH3)2S] (Van den Velde et al., 2009), mas na halitose oral ou de tipo 1, o (CH3)2S tem pouca importância, estando mais relacionado com a halitose originada no sangue ou de tipo 4, como será descrito posteriormente (Tangerman e Winkel, 2007).
Quando fisiológica, a halitose de origem oral pode ser manifestada nos primeiros momentos da manhã (mau hálito matinal) ou em estados de desidratação (após esforço físico), sendo provavelmente causada por estados de hipossalivação e apresentando pouca importância clínica (Fukui et al., 2008), já que a alimentação e a higiene bucal são suficientes para controlar esta condição (Van der Sleen et al., 2010). Outra possibilidade é a emanação de gases originados na cavidade oral como consequência de hábitos de vida, sendo diretamente relacionada ao consumo de tabaco, álcool ou de alimentos temperados, como alho e cebola (Rosenberg et al., 2007; Suarez et al., 1999). Evitar o hábito de fumar e o consumo destes alimentos é a melhor forma de prevenção (Scully e Greenman, 2012).
Em 2 (Quirynen et al., 2009) a 3% (Zürcher e Filippi, 2012) dos casos, a halitose é gerada no trato respiratório e é classificada como tipo 2 (Aydin e Harvey-Woodworth, 2014). Os gases responsáveis pelo mau odor são decorrentes da atividade de microrganismos alojados em qualquer local entre a cavidade nasal e os alvéolos pulmonares, sendo exalados pelo nariz e/ou boca (Aydin e Harvey-Woodworth, 2014).
Quando originada no estômago, a halitose é classificada como de tipo 3 (Aydin e Harvey-Woodworth, 2014), podendo ser causada pela doença do refluxo gastroesofágico (Marsicano et al., 2013) e gastrite relacionada a Helicobacter pylori (Zaric et al., 2015). Não existem relatos da incidência desta origem de halitose.
A halitose também pode ser originada no sangue e classificada como tipo 4, nestes casos a origem dos compostos é sistêmica, na qual os compostos mau cheirosos são distribuídos pelo sangue, transferidos para o ar exalado durante as
trocas gasosas pulmonares e emanados pela cavidade oral e/ou nasal (Aydin e Harvey-Woodworth, 2014).
Algumas doenças sistêmicas podem ser caracterizadas pela geração de alterações no hálito humano, como a cirrose hepática e doenças renais, nestes casos, apesar de possuir pequena importância na halitose oral, o (CH3)2S mostra-se como sendo de grande importância (Gulsahi et al., 2014; Han et al., 2014), em grande parte graças a sua natureza química, já que é uma molécula neutra, estável e que pode ser transportada do sangue para o ar alveolar e ser expirado pelo nariz e/ou cavidade oral, ao contrário do que ocorre com os outros CSV (Tangerman e Winkel, 2007).
O tipo 5 de halitose é a halitose subjetiva, ou seja, aquela que é percebida pelo indivíduo mas não detectada por outras pessoas (Aydin e Harvey-Woodworth, 2014). Há relatos de que a halitose subjetiva pode acometer de 9 a 17% dos pacientes que reportam ter halitose (Quirynen et al., 2009; Tangerman e Winkel, 2007; Zürcher e Filippi, 2012). Apesar de não ser objetiva, a halitose de tipo 5 tem grande impacto na saúde psicológica dos pacientes acometidos, podendo causar neuroses e estresse crônico (Fukui, 2010).
Aydin e Harvey-Woodworth (2014) propõem que a halitose seja diagnosticada com base na percepção da halitose pelo próprio indivíduo acometido pela doença e também por pessoas do seu convívio. Neste sentido, a quantificação organoléptica dos gases pelo cirurgião-dentista durante a consulta odontológica foi considerada por muito tempo como método de diagnóstico padrão ouro por alguns autores (Donaldson et al., 2007; Scully e Greenman, 2012). No entanto, com o desenvolvimento de métodos objetivos mais confiáveis, como a cromatografia gasosa (CG) e dos monitores de sulfetos (Yaegaki et al., 2012), essa técnica tem caído em desuso.
Um dos equipamentos mais aceitos e viáveis para a prática clínica é o Oral Chroma™ (Abilit, Osaka, Japão), um CG portátil capaz de quantificar H2S, CH3SH e (CH3)2S separadamente (Hanada et al., 2003), sendo capaz de fornecer resultados muito confiáveis (Tangerman e Winkel, 2008; Yaegaki et al., 2012).
Com relação ao perfil microbiológico da cavidade oral de indivíduos com halitose, foi demonstrado que estes pacientes possuem maior diversidade bacteriana na saburra lingual (Haraszthy et al., 2007) e que alguns periodontopatógenos
anaeróbicos Gram-negativos, como Tannerella forsythia, Treponema denticola,
Fusobacterium nucleatum e Porphyromonas gingivalis são importantes produtores de
CSV e participam no desenvolvimento da halitose (Amou et al., 2013; Kurata et al., 2008; Salako e Philip, 2011). Os gêneros Actinomyces e Veillonella, com destaque para as espécies Actinomyces odontolyticus e Veillonella dispar, foram reportados como os mais prevalentes no biofilme lingual e que quando aumentados em número podem ser responsáveis pelo mau odor oral (Washio et al., 2005). A bactéria Gram-positiva Solobacterium moorei vêm ganhando grande destaque, já que diversos autores demonstraram sua maior prevalência em pacientes com halitose quando comparados com pacientes sem halitose (Haraszthy et al., 2008; Haraszthy et al., 2007; Vancauwenberghe et al., 2013).
Apesar da maioria dos casos de pacientes com halitose objetiva possuir uma origem oral identificável durante a avaliação odontológica, alterações emocionais também tem sido sugeridas como capazes de aumentar a emanação oral de CSV. Este fenômeno foi inicialmente observado em animais, já que ratos submetidos a protocolos de estresse por imobilização e natação apresentaram aumento na produção destes gases após a aplicação dos estímulos estressores (Kurihara e Marcondes, 2002).
O aumento na emanação de CSV também foi percebido em estudos clínicos com alunos saudáveis da graduação em Odontologia momentos antes da primeira avaliação de bioquímica (Queiroz et al., 2002) e com voluntários submetidos a um protocolo de indução de ansiedade (Calil e Marcondes, 2006).
Apesar destas evidências, os mecanismos desencadeados por alterações emocionais que resultam no aumento da produção de CSV ainda não foram esclarecidos. Recentemente, foi levantado o conceito de “endocrinologia microbiana”, mostrando que microrganismos podem interagir e responder a substâncias relacionadas ao estresse e ansiedade, alterando seu metabolismo, virulência e perfil de crescimento (Akcali et al., 2013; Calil et al., 2014; Freestone et al., 2008). Assim, as alterações emocionais poderiam ser mediados por duas vias potencialmente sinérgicas: redução das defesas do hospedeiro e aumento da patogenicidade bacteriana.
Os efeitos na viabilidade, virulência e produção de CSV de substâncias relacionadas ao estresse e ansiedade já foram demonstrados em metodologias in
vitro, uma vez que a exposição de P. gingivalis à adrenalina e noradrenalina promoveu
maior expressão de genes relacionados à virulência, sem alterar sua viabilidade (Graziano et al., 2014). A produção de CSV pelas bactérias F. nucleatum, P.
endodontalis, P. intermedia e P. gingivalis também mostra-se alterada quando na
presença de adrenalina, noradrenalina e de cortisol e, além disso, estas substâncias mostraram-se capazes de alterar a viabilidade destas bactérias (Calil et al., 2014). Com base nesses achados, é possível inferir que substâncias relacionadas ao estresse e ansiedade podem interferir na viabilidade e na produção de CSV por bactérias orais.
Mais recentemente, alunos dos quatro anos de graduação do curso de Odontologia da Faculdade de Odontologia de Piracicaba foram avaliados quanto a produção de H2S, CH3SH e (CH3)2S, estresse acadêmico por meio da determinação da síndrome de burnout e dosagens salivares de Alfa-amilase (AA), Beta-defensina (BD) e Mucina 5b (MUC). Este trabalho mostrou que os voluntários do terceiro ano de graduação, que apresentaram maior estresse acadêmico, também apresentavam maior emanação oral de H2S e concentração salivar de AA e MUC associado a menor concentração salivar de BD em relação aos voluntários dos outros anos (Lima, 2013). Com base neste estudo prévio, nossa hipótese é que a alteração da composição salivar promovida pelo estresse acadêmico torna o ambiente oral favorável a produção de CSV por bactérias associadas com a halitose, causando aumento em sua quantidade e/ou de sua produtividade. Assim, os objetivos deste trabalho foram 1) avaliar a relação entre a quantidade salivar de bactérias totais e de bactérias atribuídas a halitose (T. forsythia, T. denticola, F. nucleatum, P. gingivalis,
A. odontolyticus, V. dispar e S. moorei), emanação oral de H2S, CH3SH e (CH3)2S e estresse acadêmico por meio da determinação da síndrome de burnout de alunos com boa saúde oral da graduação em odontologia da FOP-UNICAMP, 2) verificar se a AA, a BD e a MUC são capazes de alterar o perfil de crescimento destas bactérias in vitro. Esta dissertação será apresentada no formato alternativo1 e será composta de um artigo científico que se encontra em fase de submissão em revista científica.
1 De acordo com as normas estabelecidas pela deliberação 001/2015 da Comissão Central de
2 ARTIGO
Academic stress increases salivary Solobacterium moorei levels
and oral emanation of H
2S in subjects without halitosis.
Submetido ao periódico Stress: The international Journal on the Biology of Stress.
Nani, B. D., Lima, P. O., Marcondes, F. K., Groppo, F. C., Rolim G.S., Moraes, A. B. A., Cogo-Müller K., Franz-Montan, M.
ABSTRACT
Emotional states such as anxiety and stress might increase the oral emission of volatile sulfur compounds (VSC), the malodorous gases of halitosis. However, the mechanisms underlying this relationship remain unknown. Our aim was to investigate a possible association among salivary bacteria, oral VSC and academic stress in subjects without halitosis. In addition, we observed if salivary stress-related substances were capable of altering halitosis-related bacteria viability in vitro. Seventy-eight healthy undergraduate dental students were classified as stressed or not by burnout evaluation, a syndrome attributed to academic stress. Hydrogen sulfide (H2S), metylmercaptan (CH3SH) and dimetylsulfide (CH3)2S) were measured by a portable gas chromatography and the salivary amount of total bacteria and seven bacteria associated with halitosis were quantified through qPCR. The viability of these bacteria related to stress and/or malodor was also assessed in vitro in the presence of alpha-amylase, beta-defensin and mucin. Stressed students group showed increased H2S, (CH3)2S and Solobacterium moorei levels (p<0.05). Considering only stressed subjects, Fusobacterium nucleatum was correlated with S. moorei and H2S; and
Tannerella forsythia was correlated with S. moorei and F. nucleatum. These
correlations do not occur when healthy volunteers were considered. We concluded that the increased concentration of S. moorei in saliva and its association with F. nucleatum and T. forsythia might be responsible for the increased oral H2S in stressed subjects. In addition, alpha-amylase, beta-defensin and mucin did not stimulate the growth of S.
moorei and F. nucleatum.
Keywords: Halitosis, Academic stress, Solobacterium moorei, Fusobacterium
nucleatum, Tannerella forsythia, Volatile Sulphur Compounds, Hydrogen sulfide,
INTRODUCTION
Halitosis is a pathological condition in which malodor is released by mouth and/or nose (Aydin & Harvey-Woodworth, 2014). These gases can be originated in oral cavity, respiratory tract, stomach, and systemically (Yaegaki & Coil, 2000), or by a combination of these locations (Aydin & Harvey-Woodworth, 2014). In all of these cases, patients suffer from personal discomfort, embarrassment and social isolation (Tangerman & Winkel, 2007).
It is known that anaerobic bacteria degrade sulphur amino acids and produce Volatiles Sulphur Compounds (VSC), which are the major substances related to oral malodor (Persson et al, 1990). The main VSC are hydrogen sulfide (H2S), methylmercaptan (CH3SH) and dimethylsulfide [(CH3)2S] (Van den Velde et al, 2009).
Gram-negative anaerobic periodontopathogenic bacteria such as
Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola and Fusobacterium nucleatum are some of the most important VSC producers (Amou
et al, 2013; Kurata et al, 2008; Salako & Philip, 2011). Furthermore, it was reported that Actinomyces and Veillonella genus, especially the commensal bacteria
Actinomyces odontolyticus positive) and Veillonella dispar
(Gram-negative), were also associated with malodor formation (Washio et al, 2005).
Solobacterium moorei, a Gram-positive bacteria, has also been related to halitosis,
as higher levels were found on tongue coating and saliva of patients with halito sis (Haraszthy et al, 2008; Kazor et al, 2003; Vancauwenberghe et al, 2013) .
Moreover, it has been shown that anxiogenic experimental situation (Calil & Marcondes, 2006; Lima et al, 2013) and biochemistry exams (Queiroz et al, 2002) were also able to increase oral H2S production in healthy subjects,
demonstrating a positive influence of anxiety and psychological stress on oral VSC emanation. It is worth noticing that in these cases, the VSC production could not be considered halitosis, but when associated with other factors, such as poor oral hygiene, could exacerbate its production and may become halitosis.
In a recent study, it was shown that undergraduate students of dentistry had the burnout syndrome (Lima et al, 2016). This condition is characterized by psychological exhaustion, cynical attitude and professional ineffectiveness (Schaufeli et al, 2015) and is associated to perceived stress (Mafla et al, 2015). The burnout syndrome was related to increased levels of salivary alpha -amylase (AA) and mucin 5b (MUC) and a decreased concentration of beta-defensin (BD) (Lima et al, 2016).
Some studies have demonstrated that stress related substances can affect growth of several periodontopathogens (Roberts et al, 2002), up regulate the expression of virulence and oxidative stress genes of P. gingivalis (Graziano et al, 2013) and increase H2S and CH3SH production by F. nucleatum (Calil et al, 2014).
Although the relationship between psychological stress and VSC production is well documented, the mechanisms involved in such association remains unclear. In this context, we hypothesized that altered salivary composition by academic burnout syndrome represents a favorable environment for bacter ial VSC production and may be responsible for VSC rise in subjects with academic stress. Therefore, the present study evaluated the relationship between salivary bacterial amount, oral emanation of VSC and academic stress in healthy subjects, and if AA, BD and MUC are able to alter bacterial viability in vitro.
MATERIALS AND METHODS
Experimental design
Saliva samples were previously collected in another study (Lima et al, 2016) from healthy men subjects and were classified as either “Stressed” or “Not stressed” groups according to a psychometric behavior analyses (Maslach Burnout Inventory Student Survey questionnaire; MBI-SS). Following quantification of VSC, unstimulated saliva was collected and stored at -70°C. In the present study, those samples were investigated for the presence of bacterial species producing VSC. Based on VSC results, bacterial species increased in the saliva samples or correlated with VSC emanation in the “Stressed” group (S. moorei and F. nucleatum) were chosen to evaluate their in vitro viability in the presence of alpha-amylase, beta-defensin and mucin (Figure 1).
Clinical study
Seventy-eight male undergraduate students at Piracicaba Dental School (between 18 and 24 years old), which were in good oral and systemic health, were selected. Tongue coating, caries, third molar eruption, dental plaque and gingival indexes, and probing depth were clinically evaluated. The volunteers were considered with good oral health when index values for plaque and bleeding were lower than 10%. The subjects were free of periodontal pockets, defective restorations, prosthesis, caries, and third molars in eruption. Tongue coating area was measured by an index described elsewhere (Miyazaki et al, 1995) and all subjects had zero scores. This study was approved by the Ethics Committee in Research of Piracicaba Dental School, University of Campinas Piracicaba, Brazil (Protocol #. 108/2007) and volunteers provided a written informed consent (Lima et al, 2016).
Clinical data (VSC measurement and saliva collection) were obtained between 7:00 and 8:00 a.m. in the second semester of the year on three different days (0, 7, and 15) scheduled with one-day interval to stressful events (exams for example) within the 15-days period, to ensure that stress conditions were caused by regular academic activities. The average of the three collections were considered.
The volunteers were instructed to refrain from using any oral rinse or breath freshener for a week, eating spicy foods, or those containing onion or garlic, for 24 h, practicing their oral hygiene habits, using of scented cosmetics or after-shave lotions and eating or drinking (including water) for 8 h before the experiment (Calil & Marcondes, 2006).
The unstimulated saliva collection was carried out as recommended elsewhere (Calil et al, 2008; Calil & Marcondes, 2006). The subjects were instructed to avoid swallowing for five minutes. Subsequently, the total volume of saliva was placed in a
plastic tube kept on ice. Immediately after collection, saliva was homogenized using a vortex mixer and stored in a freezer at -70ºC until analysis.
Volunteers’ oral breath sample (1 mL of mouth air) was obtained with plastic disposable syringes, after 1 minute having their mouth closed. The VSC measurements were performed by injecting 0.5 mL of the sample into a portable gas chromatograph (Oral Chroma™, Ability; Osaka, Japan), which separates and quantify the concentration (in ppb) of H2S, CH3SH and (CH3)2S.
Following data collection, volunteers were classified into two groups: G1 - “Stressed” or G2 - “Not stressed”. Stress was evaluated by quantification of burnout syndrome, a primarily state of long-term work-related mental exhaustion, accompanied by diminished interest and disengagement (Schaufeli et al, 2015) that is directly related to perceived stress (Mafla et al, 2015). Volunteers were invited to answer the MBI-SS questionnaire (Schaufeli et al, 2015), which is used to detect burnout syndrome in undergraduate dental students (Campos et al, 2012; Mafla et al, 2015). This syndrome is triggered by chronic academic stress and it is characterized by high emotional exhaustion, cynicism and low academic efficacy (Schaufeli et al, 2015).
The questionnaire consists of 15 questions divided into three categories: exhaustion (five items), cynicism (four items), and efficacy (six items). All questions are scored on a 7-point frequency rating scale ranging from 0 (never) to 6 (every day). This evaluation has a three-dimensional burnout concept, whereas high scores on emotional exhaustion and cynicism and low scores on academic efficacy indicate a high degree of burnout. Classification of volunteers was performed according to the sum of scores for each category (range 0-90 points). The volunteers were considered as “stressed” when the scores sum were above the third quartile and as “not stressed” when the scores sum were below the third quartile (Schaufeli et al, 2015).
Microbial quantitative analysis
The microbial quantitative analysis was performed with saliva samples collected previously as described above. This evaluation was approved by Ethics Committee in Research of Piracicaba Dental School, University of Campinas Piracicaba, Brazil (Protocol #147/2014).
Saliva samples from the three collections days from each volunteer were pooled for bacterial quantification. Quantitative real-time Polymerase Chain Reaction (qPCR) was carried out in order to quantify total bacterial counts an d main oral bacterial species that produce VSCs. 520 µL of saliva was centrifuged at 13,523 g for 10 min at 4ºC. The supernatant was discarded and the pellet was used for DNA extraction using a genomic DNA detection kit (PureLinkTM Genomic DNA Mini Kit, Invitrogen, Carlsbad, CA, USA). The protocol was performed according to the manufacturer, except for the lysis time (Proteinase K and PurelinkTM Genomic Lysis/Binding Buffer step) which was changed from 30 min to 2 hours. The final elution was made in 25 µL of elution buffer. Following extraction, the DNA concentration was determined using a small volume spectrophotometer (PICOPET01, Picodrop Ltd, Alpha Biotech Ltd, Killearn, Glasgow, Scotland).
All species-specific primers for A. odontolyticus, T. forsythia, T. denticola, P.
gingivalis and total bacterial counts target the 16SrRNA gene (Kuboniwa et al,
2004; Saito et al, 2011; Suzuki et al, 2005; Yang et al, 2007; Yang et al, 2002) . Since Fusobacterium and Veillonella genus have high level of genotypic similarity between their species, primers for F. nucleatum and V. dispar targeting the rpoB
gene, which is a specie-specific gene, was used (Igarashi et al, 2009; Park et al,
2013). S. moorei primer targeting 16SrRNA gene was designed using the Primer 3 software (Untergasser et al, 2012). All primers were tested for specificity in the
NCBI BLAST Database (Ye et al, 2006). Table 1 shows the sequences of primers used in this study.
Table 1. Species specific primers used in the real-time PCR.
Bacteria Gene Primer Sequence (5' → 3') Reference
A. odontolyticus 16SrRNA F CTTTGGGATAACGCCGGGAAAC (Yang et al, 2007) R CTACCCGTCAAAGCCTTGGT
F. nucleatum rpob F ACCTAAGGGAGAAACAGAACCA (Park et al, 2013) R CCTGCCTTTAATTCATCTCCAT
P. gingivalis 16SrRNA F ACCTTACCCGGGATTGAAATG (Saito et al, 2011) R CAACCATGCAGCACCTACATAGAA
S. moorei 16SrRNA F CTCAACCCAATCCAGCCACT Designed in this
study R TATTGGCTCCCCACGGTTTC
T. forsythia 16SrRNA F AGCGATGGTAGCAATACCTGTC (Kuboniwa et al,
2004) R TTCGCCGGGTTATCCCTC
T. denticola 16SrRNA F CCGAATGTGCTCATTTACATAAAGGT (Suzuki et al, 2005) R GATACCCATCGTTGCCTTGGT Total Bacterial Counts 16SrRNA F TGGAGCATGTGGTTTAATTCGA (Yang et al, 2002) R TGCGGGACTTAACCCAACA
V. dispar rpob F AACGCGTTGAAATTCGTCATGAAC (Igarashi et al, 2009) R GTGTAACAAGGGAGTACGGACC
The qPCR reaction was carried out in a total volume of 10 µL, contain ing 5 µL of SYBR® Select Master Mix (Thermo Fisher Scientific, Waltham, USA), 2 µL of DNA template and 1 µL of primer pair solution (300 mM/reaction). For each run, DEPC Treated Water (Thermo Fisher Scientific, Waltham, USA) was used as the negative control and melting peaks were used to determine the specificity of the PCR. Amplification of the extracted DNA template was performed in a real time PCR system (Step One Plus®, Thermo Fisher Scientific, Waltham, USA) by an initial incubation of 2 min at 50ºC and 2 min at 95ºC, followed by 40 cycles of 15 s at 95ºC and 30 s at 60ºC.
The absolute quantification of the target bacteria was performed by comparing the Ct value for the saliva samples with Ct values from a standard curve (102 - 108 CFU/mL) obtained from pure cultures of the bacterial species studied
(Casarin et al, 2010). Calculations were carried out to obtain the number of bacteria per mL of saliva (cells/mL).
In vitro bacterial viability
Bacterial Samples and Culture Conditions
S. moorei (DSM 22971) was maintained on Tryptic Soy Agar (TSA, Bacto™,
Difco, Le Pont de Claix, France) supplemented with sheep blood (7% v/v). F.
nucleatum (NCTC 11326) was kept on TSA supplemented with 0.2% Yeast Extract
(YE, Bacto™ Difco, Le Pont de Claix, France), 5 µg/mL of hemin (HE; Sigma, Poole, UK), 1 µg/mL of menadione (ME; Sigma, Poole, UK) and 5% sheep blood (v/v). The cultures were grown under anaerobic conditions (10% CO2, 10% H2 and 80% N2) in an anaerobic chamber (MiniMacs Anaerobic Workstation, Don Whitley Scientific, Shipley, UK) at 37°C.
Viability assay
The experimental design was adapted from previously reported studies (Cogo et al, 2009; Graziano et al, 2013; Roberts et al, 2002). In order to observe the effect of alpha-amylase from human saliva (Sigma®; Poole, UK), human beta-defensin 2 (Sigma), and mucin from porcine stomach (Sigma) in both S. moorei and F. nucleatum cultures, a 100 µL serial dilution of each substance was placed in a 96-wells plate. Solutions were prepared using distilled-deionized water and were sterilized using 0.22 µm sterile filters. Two-fold serial dilutions from 300 to 0.1 U/mL for alpha-amylase; 100,000 to 49 pg/mL for beta-defensin; and 7,500 to 4 µg/mL for mucin were performed to test bacteria viability. These dilutions were designed to mimic the salivary concentration of the tested substances in subjects under academic stress condition, according to the results obtained in the clinical study (Lima et al, 2016). The dilutions were made in Tryptic Soy Broth (TSB, Bacto™, Difco, Le Pont de Claix, France)
supplemented with bovine serum (5% v/v) for S. moorei and TSB supplemented with 0.2% YE, 5 µg/mL of HE and 1 µg/mL of ME for F. nucleatum. Cultures of S. moorei and F. nucleatum growing for 24 and 48 h, respectively, were used to prepare a bacterial suspension with an optical density of 0.5 at 660 nm (OD660). 100 µL of this suspension was inoculated in each well (200 µL final volume), resulting in a final bacterial suspension of 108 CFU/mL.
Samples with inoculum, but without any of the tested substances, were used as positive controls. Samples with substances and without bacteria were used as negative controls. After anaerobic incubation at 37°C for 24 and 48 h (S. moorei and
F. nucleatum, respectively), bacterial growth was assessed by measuring the OD660. The experiment was carried out with 6 replicates per experimental group, at least 2 times.
Statistical Analysis
Spearman’s correlation coefficients (rS) were calculated for VSC production and bacterial quantification. For bacterial quantification, data were expressed in terms of percentage representing the relative proportion of each species in relation to total quantification. Data distribution was tested using the Shapiro-Wilk test. Non-normally distributed data were analyzed using Mann-Whitney (U) test (bacterial quantification and clinical VSC). Data showing normal distribution were compared using ANOVA (F), and differences between control and each treatment groups were determined using the Dunnet post-hoc test (growth assays). The significance level was set at 5% and all analyses were performed using the statistical software GraphPad Prism, version 6.0 for windows (Graph Pad Software Inc; Los Angeles, USA).
RESULTS
CSV production and Microbial quantitative analysis
The subjects were categorized into “Stressed” (“S”, n = 21, 20.5 ± 1.9 years; mean ± standard deviation) and “Not stressed” (“NS”, n = 57, 20.5 ± 1.4 years; mean ± standard deviation) groups based on MBI-SS results.
The results of production of H2S, CH3SH and (CH3)2S by volunteers in both groups are shown in Figure 2. Data are expressed as median, interquartile range (IQR), followed by Mann-Whitney U (U), degrees of freedom and p value. “Stressed” group had higher levels of H2S [S = 57.7 (53.7) ppb; NS = 41.0 (25.4) ppb; U (2) = 400.0, df = 77 and p = 0.03] and (CH3)2S [S= 5.2 (6.8) ppb; NS = 3.3 (5.3) ppb; U (2) = 343.5, df = 77 and p = 0.01] than “No stress” group. There was no difference between groups for CH3SH production (p > 0.05).
Figure 2. Box plot (maximum, 75th percentile, median, 25th percentile and minimum)
of H2S (a), CH3SH (b) and (CH3)2S (c) measured by a portable gas chromatograph of volunteers from “Stressed” and “Not stressed” groups. Mann-Whitney test, * p < 0.05. The total bacterial counts and the relative proportion of bacterial species producing VSC, such as A. odontolyticus, F. nucleatum, P. gingivalis, S. moorei, T.
denticola, T. forsythia, and V. dispar, in saliva samples of volunteers from “Stressed”
Figure 3. Box plot (maximum, 75th percentile, median, 25th percentile and minimum)
of total bacterial counts (a) and relative proportion (percentage from the total bacteria) of the following bacteria in relation to total bacterial counts A. odontolyticus (b); S.
moorei (c); V. dispar (d); F. nucleatum (e); T. denticola (f); T. forsythia (g) of volunteers
There was no significant differences between “Stressed” and “Not stressed” groups for total bacterial counts per mL of saliva and the relative proportions (percentage from the total bacteria) of A. odontolyticus, V. dispar, F. nucleatum, T.
denticola and T. forsythia (p > 0.05). However, there was a statistically difference
between groups for the relative proportion of S. moorei (S = 2.3 (3.1); NS = 1.3 (1.7); U (2) = 307.0, df = 77 andp = 0.02). For both groups, saliva samples were negative for P. gingivalis.
Table 2 shows relationship between VSC measures and saliva bacterial quantification (Spearman correlation test).
Table 2. Correlation coefficients (rS) between H2S, CH3SH and (CH3)2S with bacterial relative proportions of A. odontolyticus, F. nucleatum, S. moorei, T. denticola, T.
forsythia and V. dispar in subjects from “Stressed” and “Not stressed” groups.
Stressed Not Stressed H2S CH3SH (CH3)2S H2S CH3SH (CH3)2S A. odontolyticus -0.18 0.00 0.40 0.15 0.15 0.05 F. nucleatum 0.51* 0.53* 0.29 -0.01 -0.09 -0.02 S. moorei 0.13 0.51* 0.42 0.25 0.25 0.16 T. denticola -0.22 -0.05 0.18 -0.13 -0.03 -0.01 T. forsythia 0.38 0.24 0.23 -0.01 -0.19 0.06 V. dispar 0.00 0.01 -0.01 -0.07 0.08 -0.29
Spearman´s correlation test, * = p > 0.05.
There was no correlation among A. odontolyticus, T. denticola, T. forsythia and
nucleatum, H2S and CH3SH; and S. moorei and CH3SH in the “Stress” group (Table
2).
According to data presented (Figure 3 and Table 2) S. moorei and F.
nucleatum may be responsible for the increased level of VSC production in the “Stress”
group (Figure 2). Therefore, a Spearman correlation test was performed in order to verify the relationship between the relative proportion of S. moorei and F. nucleatum and other bacterial species into “Stressed” and “Not stressed” groups, according to the results shown in Table 3.
Table 3. Correlation coefficients (rS) between relative proportions of S. moorei, F.
nucleatum and relative proportions of A. odontolyticus (Ao), F. nucleatum (Fn), T. denticola (Td), T. forsythia (Tf) and V. dispar (Vd) from “Stressed” and “Not stressed”
groups.
Stressed Not Stressed
Ao Fn Td Tf Vd Ao Fn Td Tf Vd
S. moorei 0.46 * 0.59 ** 0.36 0.53 * 0.16 0.61 *** 0.08 0.18 0.09 0.35 **
F. nucleatum 0.20 - 0.09 0.55 ** 0.31 0.10 - 0.11 0.25 -0.17 Spearman´s correlation test, * = p < 0.01, ** = p < 0.001 and *** = p < 0.0001.
There was a moderate positive correlation between A. odontolyticus and S.
moorei when considering subjects of “Stressed” and “Not stressed” groups. While a
weak correlation between V. dispar and S. moorei was only found in the “Not stressed” group. On the other hand, a moderate positive correlation between F. nucleatum and
S. moorei; T. forsythia and S. moorei; T. forsythia and F. nucleatum were only found
In vitro bacterial viability
The in vitro bacterial viability in the presence of alpha-amylase, beta-defensin, and mucin were conducted only with F. nucleatum and S. moorei, considering their higher levels and positive correlation with production of VSC in the “Stressed” group, as shown in Figure 4.
Figure 4. Effect of alpha-amylase (a, d), beta-defensin (b, e) and mucin (c, f) on viability of F. nucleatum and S. moorei.
Viability of F. nucleatum and S. moorei were not influenced by the presence of alpha-amylase, beta-defensin and mucin in the concentrations evaluated in the present study (p > 0.05).
DISCUSSION
Halitosis is characterized by an emanation of malodorous compounds from oral cavity (Yaegaki & Coil, 2000). The main gases are H2S, CH3SH and (CH3)2S, which are produced by anaerobic microorganisms through degradation of sulphur-containing proteins (Persson et al, 1990). It has been shown that psychological stress and anxiety may aggravate this condition (Calil & Marcondes, 2006; Lima et al, 2013; Queiroz et al, 2002), but the mechanisms involved in this relationship remains unclear. In the present study, we found subjects with increased oral production of H2S and (CH3)2S, while harboring higher proportions of S. moorei during academic stress experience. In addition, S. moorei proportions were correlated with F. nucleatum and
T. forsythia levels, which may have contributed to the higher levels of VSC production
in these subjects.
Many factors can affect the oral VSC emanation such as periodontal disease (Amou et al, 2013), presence of tongue coating (Tangerman & Winkel, 2007), menstrual cycle and gender (Calil et al, 2008), and systemic diseases (Tangerman & Winkel, 2007). In our study, these factors were controlled, since the volunteers were all men with good oral and systemic health. Moreover, MBI-SS questionnaires showed that 21 subjects had burnout syndrome. Considering that the burnout syndrome is directly related to the perceived stress (Mafla et al, 2015), we assumed that the measured stress was the distinct factor between groups in this study.
Although the subjects had never complained about oral malodor, the portable gas chromatograph was able to detect higher amounts of H2S in the “Stressed” group. Similarly, it was previously reported by others that anxiogenic experimental situations (Calil & Marcondes, 2006; Lima et al, 2013) and academic exams were able to increase the VSC production in undergraduate students (Queiroz et al, 2002).
We demonstrated that subjects under chronic stress presents higher proportions of S. moorei. This anaerobic bacteria is related to objective halitosis, since its prevalence is higher in tongue coating of patients with halitosis (Haraszthy et al., 2008; Haraszthy et al., 2007). Although the subjects of the present study did not have halitosis and presented low tongue coating scores, the “Stressed” group showed high salivary levels of S. moorei in comparison to the “Not stressed” group, indicating that
S. moorei might be important for the increased production of VSC in healthy stressed
subjects.
Saliva bacterial composition reflects the overall condition of the oral cavity, including tongue coating (Sakamoto et al, 2001; Vancauwenberghe et al, 2013). Similar to the positive correlations found in the present study, S. moorei and malodor parameters from both tongue coating and saliva samples were also reported by others (Vancauwenberghe et al, 2013). Furthermore, our results show that increased relative proportion of S. moorei in saliva could be related to the rise of VSC in stressed healthy undergraduate students.
S. moorei seems to be a low VSC producer when compared to other oral
microorganisms, but is unable to produce CH3SH (Stephen et al, 2014). We found a moderate positive correlation between S. moorei and CH3SH in stressed subjects, which indicates that the presence of a stress condition might be important to produce it. However, additional data is necessary to confirm this hypothesis and to understand the possible mechanisms underlying this association.
F. nucleatum relative proportions did not show significant differences between
“Stressed” and “Not stressed” groups, but it presented a moderate positive correlation with H2S and CH3SH levels only in stressed subjects. These results are in accordance with the literature, since F. nucleatum has a moderate ability to produce H2S, but is
one of the leading producers of CH3SH (Salako & Philip, 2011; Stephen et al, 2014). Therefore, our findings indicate that F. nucleatum may be responsible for higher levels of these gases in “Stressed” group and this rise may be explained by a possible direct stimulation on VSC production.
Another mechanism that could explain the rises in VSC production by F.
nucleatum is the ability of S. moorei to interact to other bacteria, including species of Fusobacterium, as suggested by other authors (Martin et al, 2007; Schirrmeister et al,
2009; Stephen et al, 2014). Accordingly, S. moorei was found in higher amounts in “Stressed” group and presented a moderate positive correlation with the presence of
F. nucleatum. Moreover, S. moorei was correlated to increased production CH3SH in “Stressed” group, even though it is not able to produce this gas.
It was shown that although gram-positive microorganisms are low producers of VSC, they play an important role for malodor formation, since they are responsible for the first enzymatic step (deglycosylation), necessary to the subsequent protein degradation by gram-negative species (Sterer & Rosenberg, 2006). Considering this, it is possible that S. moorei (Gram-positive) may be responsible for deglycosylation, and F. nucleatum (Gram-negative) for posterior protein degradation, resulting in raised levels of VSC in stressed subjects. This interaction could be related to the H2S production, as we found that stressed subjects presented high levels of this gas, but not increased CH3SH release.
The relationship between psychological stress and the development of infectious diseases has been studied (Akcali et al, 2013; Graziano et al, 2013). Recently, the concept of “microbial endocrinology” was raised, showing that microorganisms can interact and react to stress related substances, altering its metabolism, virulence and growth profile (Calil et al, 2014; Freestone et al, 2008).
Previously, adrenaline and noradrenaline were shown to affect periodontal microorganisms’ growth (Roberts et al, 2002). Moreover, the presence of cortisol, noradrenaline and adrenaline increased the in vitro production of H2S by F. nucleatum,
Porphyromonas endodontalis and Prevotella intermedia (Calil et al, 2014).
Recently, our research group evaluated the saliva composition of patients without halitosis and found that stressed subjects presented increased levels of the salivary alpha-amylase and mucin MUC5B, and decreased levels of beta-defensin (Lima et al, 2016). Therefore, we hypothesized that stress-related substances, such as alpha-amylase, mucin and beta-defensin, could affect the growth of S. moorei and
F. nucleatum. In this preliminary study, beta-defensin, mucin and alpha-amylase did
not affect the in vitro viability of S. moorei and F. nucleatum in the tested concentrations. However, other stress-related substances and other bacterial species should be tested in order to confirm this hypothesis.
Although these stressed-related substances did not affect bacterial growth, other mechanisms may be involved in the higher bacterial production of VSC found in the “Stressed” group. Graziano et al (2013) showed that adrenaline and noradrenaline did not alter the viability nor the antimicrobial resistance of P. gingivalis, but they up-regulated the expression of virulence and oxidative stress genes (Graziano et al, 2013). In the present study, the higher production of VSC levels by S. moorei and F.
nucleatum, could be related to an up-regulation of enzymes involved in their production
such as β-galactosidase, deglycosylating enzymes (Sterer & Rosenberg, 2006) or METases enzymes, which are responsible for CH3SH formation (Nakano et al, 2002). Future studies should be conducted in order to confirm the interaction between stress substances and bacterial VSC production.
T. forsythia was found in very low relative proportion in both “Stressed” and
“Not stressed” groups. However, this species showed moderate positive correlation with S. moorei and F. nucleatum only in stressed subjects, suggesting that it might be related to them in stress condition. Although some authors have found this bacteria in greater proportion in subjects with halitosis (Awano et al, 2002; Kazor et al, 2003), it is rarely found in healthy subjects (Tanaka et al, 2004). To our knowledge, no other study have demonstrated any correlation among S. moorei, F. nucleatum and T. forsythia, and additional studies are necessary to elucidate this relationship.
Volunteers of “Stressed” group showed an increased oral emanation of (CH3)2S. The production of this gas has been reported to be associated with extra-oral halitosis (Gulsahi et al, 2014; Han et al, 2014; Tangerman & Winkel, 2007). However, the presence of (CH3)2S at oral cavity could be associated to its release from blood to saliva, which was detected by the portable gas chromatograph.
In fact, the bacterial species evaluated here usually do not produce detectable levels of this gas, which was confirmed by the absence of correlation among the species and (CH3)2S production. Moreover, it is possible that other bacteria are responsible for its production. Pseudomonas aeruginosa was revealed as a producer of this gas (Zscheppank et al, 2014). Nevertheless, P. aeroginosa was not evaluated in the present study, since this bacteria is not associated with halitosis. Therefore, more studies are necessary to understand why (CH3)2S is released in subjects under stress situation.
CONCLUSION
Academic stress condition can stimulate the production of H2S in healthy subjects with no diagnosis of halitosis, by increasing levels of S. moorei in the presence of F. nucleatum. T. forsythia may also participate in this process. These findings indicate that these bacteria are important for the development of halitosis due to emotional changes.
Alpha-amylase, beta-defensin and mucin did not stimulate the growth of both
S. moorei and F. nucleatum, and other substances probable participate in this process.
It remains unclear why (CH3)2S production is increased in those individuals.
ACKNOWLEDGEMENTS
Financial support was provided by the São Paulo Research Foundation (FAPESP, grant #2011/50419-2). Bruno Dias Nani acknowledges the scholarship provided by FAPESP (grant #2013/26691-0).
DECLARATION OF INTEREST
There are no conflicts of interest associated with this study.
REFERENCES
Akcali A, Huck O, Tenenbaum H, Davideau JL, Buduneli N. Periodontal diseases and stress: a brief review. J Oral Rehabil. 2013;40(1):60-8.
Amou T, Hinode D, Yoshioka M, Grenier D. Relationship between halitosis and periodontal disease - associated oral bacteria in tongue coatings. Int J Dent Hyg. 2013;12(2):145-51.
Awano S, Gohara K, Kurihara E, Ansai T, Takehara T. The relationship between the presence of periodontopathogenic bacteria in saliva and halitosis. Int Dent J. 2002;52 Suppl 3:212-6.
Aydin M, Harvey-Woodworth CN. Halitosis: a new definition and classification. Br Dent J. 2014;217(1):E1.
Calil CM, Lima PO, Bernardes CF, Groppo FC, Bado F, Marcondes FK. Influence of gender and menstrual cycle on volatile sulphur compounds production. Arch Oral Biol. 2008;53(12):1107-12.
Calil CM, Marcondes FK. Influence of anxiety on the production of oral volatile sulfur compounds. Life Sci. 2006;79(7):660-4.
Calil CM, Oliveira GM, Cogo K, Pereira AC, Marcondes FK, Groppo FC. Effects of stress hormones on the production of volatile sulfur compounds by periodontopathogenic bacteria. Braz Oral Res. 2014;28.
Campos JA, Jordani PC, Zucoloto ML, Bonafé FS, Maroco J. Burnout syndrome among dental students. Rev Bras Epidemiol. 2012;15(1):155-65.
Casarin RC, Ribeiro EeP, Mariano FS, Nociti FH, Casati MZ, Gonçalves RB. Levels of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, inflammatory cytokines and species-specific immunoglobulin G in generalized aggressive and chronic periodontitis. J Periodontal Res. 2010;45(5):635-42.
Cogo K, Calvi BM, Mariano FS, Franco GC, Gonçalves RB, Groppo FC. The effects of nicotine and cotinine on Porphyromonas gingivalis colonisation of epithelial cells. Arch Oral Biol. 2009;54(11):1061-7.
Freestone PP, Sandrini SM, Haigh RD, Lyte M. Microbial endocrinology: how stress influences susceptibility to infection. Trends Microbiol. 2008;16(2):55-64.
Graziano TS, Closs P, Poppi T, Franco GC, Cortelli JR, Groppo FC, Cogo K. Catecholamines promote the expression of virulence and oxidative stress genes in Porphyromonas gingivalis. J Periodontal Res. 2014 Oct;49(5):660-9.
Gulsahi A, Evirgen S, Öztaş B, Genç Y, Çetinel Y. Volatile sulphur compound levels and related factors in patients with chronic renal failure. J Clin Periodontol. 2014;41(8):814-9.
Han DH, Lee SM, Lee JG, Kim YJ, Kim JB. Association between viral hepatitis B infection and halitosis. Acta Odontol Scand. 2014;72(4):274-82.
Haraszthy VI, Gerber D, Clark B, Moses P, Parker C, Sreenivasan PK, et al. Characterization and prevalence of Solobacterium moorei associated with oral halitosis. J Breath Res. 2008;2(1):017002. doi: 10.1088/1752-7155/2/1/017002. PubMed PMID: 21386146.
Haraszthy VI, Zambon JJ, Sreenivasan PK, Zambon MM, Gerber D, Rego R, Parker C. Identification of oral bacterial species associated with halitosis. J Am Dent Assoc. 2007;138(8):1113-20.
Igarashi E, Kamaguchi A, Fujita M, Miyakawa H, Nakazawa F. Identification of oral species of the genus Veillonella by polymerase chain reaction. Oral Microbiol Immunol. 2009;24(4):310-3.
Kazor CE, Mitchell PM, Lee AM, Stokes LN, Loesche WJ, Dewhirst FE, Paster BJ. Diversity of bacterial populations on the tongue dorsa of patients with halitosis and healthy patients. J Clin Microbiol. 2003;41(2):558-63.
Kuboniwa M, Amano A, Kimura KR, Sekine S, Kato S, Yamamoto Y, Okahashi N, Iida T, Shizukuishi S. Quantitative detection of periodontal pathogens using real-time polymerase chain reaction with TaqMan probes. Oral Microbiol Immunol. 2004;19(3):168-76.
Kurata H, Awano S, Yoshida A, Ansai T, Takehara T. The prevalence of periodontopathogenic bacteria in saliva is linked to periodontal health status and oral malodour. J Med Microbiol. 2008;57(Pt 5):636-42.
Lima PO, Lima AR, Rolim GS, Franco GCN, Clemente-Napimoga J, Moraes ABA, Marcondes FK. Influence of stress on salivary proteins and volatile sulfur compounds. Submitted for PLOSOne journal in January 2016.
Lima PO, Calil CM, Marcondes FK. Influence of gender and stress on the volatile sulfur compounds and stress biomarkers production. Oral Dis. 2013;19(4):366-73.
Mafla AC, Villa-Torres L, Polychronopoulou A, Polanco H, Moreno-Juvinao V, Parra-Galvis D, Durán C, Villalobos MJ, Divaris K. Burnout prevalence and correlates amongst Colombian dental students: the STRESSCODE study. Eur J Dent Educ. 2015;19(4):242-50.
Martin CA, Wijesurendra RS, Borland CD, Karas JA. Femoral vein thrombophlebitis and septic pulmonary embolism due to a mixed anaerobic infection including Solobacterium moorei: a case report. J Med Case Rep. 2007;1:40.
Miyazaki H, Sakao S, Katoh Y, Takehara T. Correlation between volatile sulphur compounds and certain oral health measurements in the general population. J Periodontol. 1995;66(8):679-84.
Nakano Y, Yoshimura M, Koga T. Methyl mercaptan production by periodontal bacteria. Int Dent J. 2002;52 Suppl 3:217-20.
Park SN, Lim YK, Kook JK. Development of quantitative real-time PCR primers for detecting 42 oral bacterial species. Arch Microbiol. 2013;195(7):473-82.
Persson S, Edlund MB, Claesson R, Carlsson J. The formation of hydrogen sulfide and methyl mercaptan by oral bacteria. Oral Microbiol Immunol. 1990;5(4):195-201.
Queiroz CS, Hayacibara MF, Tabchoury CP, Marcondes FK, Cury JA. Relationship between stressful situations, salivary flow rate and oral volatile sulfur-containing compounds. Eur J Oral Sci. 2002;110(5):337-40.
Roberts A, Matthews JB, Socransky SS, Freestone PP, Williams PH, Chapple IL. Stress and the periodontal diseases: effects of catecholamines on the growth of periodontal bacteria in vitro. Oral Microbiol Immunol. 2002;17(5):296-303.
Saito T, Inagaki S, Sakurai K, Okuda K, Ishihara K. Exposure of P. gingivalis to noradrenaline reduces bacterial growth and elevates ArgX protease activity. Arch Oral Biol. 2011;56(3):244-50.
Sakamoto M, Takeuchi Y, Umeda M, Ishikawa I, Benno Y. Rapid detection and quantification of five periodontopathic bacteria by real-time PCR. Microbiol Immunol. 2001;45(1):39-44.
Salako NO, Philip L. Comparison of the use of the Halimeter and the Oral Chroma™ in the assessment of the ability of common cultivable oral anaerobic bacteria to produce malodorous volatile sulfur compounds from cysteine and methionine. Med Princ Pract. 2011;20(1):75-9.
Schaufeli W, Martínez I, Pinto A, Salanova M, Bakker A. Burnout and engagement in university students. J Cross Cult Psychol. 2015;33(5):464 – 81.
Schirrmeister JF, Liebenow AL, Pelz K, Wittmer A, Serr A, Hellwig E, Al-Ahmad A. New bacterial compositions in root-filled teeth with periradicular lesions. J Endod. 2009;35(2):169-74.
Scully C, Greenman J. Halitology (breath odour: aetiopathogenesis and management). Oral Dis. 2012;18(4):333-45.
Stephen AS, Naughton DP, Pizzey RL, Bradshaw DJ, Burnett GR. In vitro growth characteristics and volatile sulfur compound production of Solobacterium moorei. Anaerobe. 2014;26:53-7.
Sterer N, Rosenberg M. Streptococcus salivarius promotes mucin putrefaction and malodor production by Porphyromonas gingivalis. J Dent Res. 2006;85(10):910-4.
Suzuki N, Yoshida A, Nakano Y. Quantitative analysis of multi-species oral biofilms by TaqMan Real-Time PCR. Clin Med Res. 2005;3(3):176-85.
Tanaka M, Yamamoto Y, Kuboniwa M, Nonaka A, Nishida N, Maeda K, Kataoka K, Nagata H, Shizukuishi S. Contribution of periodontal pathogens on tongue dorsa analyzed with real-time PCR to oral malodor. Microbes Infect. 2004;6(12):1078-83.
Tangerman A, Winkel EG. Intra- and extra-oral halitosis: finding of a new form of extra-oral blood-borne halitosis caused by dimethyl sulphide. J Clin Periodontol. 2007;34(9):748-55.
Untergasser A1, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115.
Van den Velde S, van Steenberghe D, Van Hee P, Quirynen M. Detection of odorous compounds in breath. J Dent Res. 2009;88(3):285-9.
Vancauwenberghe F1, Dadamio J, Laleman I, Van Tornout M, Teughels W, Coucke W, Quirynen M. The role of Solobacterium moorei in oral malodour. J Breath Res. 2013;7(4):046006.
Washio J, Sato T, Koseki T, Takahashi N. Hydrogen sulfide-producing bacteria in tongue biofilm and their relationship with oral malodour. J Med Microbiol. 2005;54(Pt 9):889-95.
Yaegaki K, Coil JM. Examination, classification, and treatment of halitosis; clinical perspectives. J Can Dent Assoc. 2000;66(5):257-61.
Yang R, Zou J, Li JY. [Study of the relationship between oral Actinomyces and childhood caries]. Hua Xi Kou Qiang Yi Xue Za Zhi. 2007;25(6):568-70.
Yang S, Lin S, Kelen GD, Quinn TC, Dick JD, Gaydos CA, Rothman RE. Quantitative multiprobe PCR assay for simultaneous detection and identification to species level of bacterial pathogens. J Clin Microbiol. 2002;40(9):3449-54.
Ye J, McGinnis S, Madden TL. BLAST: improvements for better sequence analysis. Nucleic Acids Res. 2006;34(Web Server issue):W6-9.
3 CONCLUSÃO
Em conclusão, o estresse acadêmico é capaz de estimular a produção oral de H2S e (CH3)2S e aumentar os níveis salivares de S. moorei em pacientes saudáveis. Ainda, o aumento na quantidade salivar de S. moorei correlaciona-se aos níveis de F. nucleatum e T. forsythia, indicando que estas bactérias são importantes para o desenvolvimento da halitose decorrente de alterações emocionais. Alfa-amilase, beta-defensina e mucinas parecem não alterar a viabilidade destas bactérias
in vitro. Dessa forma, estudos futuros são necessários para investigar se estas
substâncias são capazes de aumentar a produtividade bacteriana de CSV.
Permanecem desconhecidos os mecanismos responsáveis pelo aumento na emanação oral de (CH3)2S, uma vez que as bactérias estudadas não se correlacionaram com este CSV e não há relatos de bactérias produtoras de (CH3)2S associadas com a halitose.
REFERÊNCIAS
*Akcali A, Huck O, Tenenbaum H, Davideau JL, Buduneli N. Periodontal diseases and stress: a brief review. J Oral Rehabil. 2013;40(1):60-8.
Amou T, Hinode D, Yoshioka M, Grenier D. Relationship between halitosis and periodontal disease - associated oral bacteria in tongue coatings. Int J Dent Hyg. 2013. Aydin M, Harvey-Woodworth CN. Halitosis: a new definition and classification. Br Dent J. 2014;217(1):E1.
Bosy A. Oral malodor: philosophical and practical aspects. J Can Dent Assoc. 1997;63(3):196-201.
Calil CM, Marcondes FK. Influence of anxiety on the production of oral volatile sulfur compounds. Life Sci. 2006;79(7):660-4.
Calil CM, Oliveira GM, Cogo K, Pereira AC, Marcondes FK, Groppo FC. Effects of stress hormones on the production of volatile sulfur compounds by periodontopathogenic bacteria. Braz Oral Res. 2014;28.
Donaldson AC, Riggio MP, Rolph HJ, Bagg J, Hodge PJ. Clinical examination of subjects with halitosis. Oral Dis. 2007;13(1):63-70.
Freestone PP, Sandrini SM, Haigh RD, Lyte M. Microbial endocrinology: how stress influences susceptibility to infection. Trends Microbiol. 2008;16(2):55-64.
Fukui Y, Yaegaki K, Murata T, Sato T, Tanaka T, Imai T, Kamoda T, Herai M. Diurnal changes in oral malodour among dental-office workers. Int Dent J. 2008;58(3):159-66. Fukui M, Hinode D, Yokoyama M, Yoshioka M, Kataoka K, Ito HO. Levels of salivary stress markers in patients with anxiety about halitosis. Arch Oral Biol. 2010;55(11):842-7.
Graziano TS, Closs P, Poppi T, Franco GC, Cortelli JR, Groppo FC, Cogo K. Catecholamines promote the expression of virulence and oxidative stress genes in Porphyromonas gingivalis. 2014 Oct;49(5):660-9.
* De acordo com as normas da UNICAMP/FOP, baseadas na padronização do International Committee of Medical Journal Editors - Vancouver Group. Abreviatura dos periódicos em conformidade com o
