[PDF] Top 20 Association of serotonin transporter gene polymorphism 5HTTVNTR with osteoporosis

... 5HTT gene, one located within intron 2 (5HTTVNTR) and the other in the promoter (5HT- ...For 5HTTVNTR we used the primers 5’GTCAGTATCACAGGCTGC - GAG3’ and 5’TGTTCCTAGTCTTACGCCAGTG3’ and the ... See full document

... T102C polymorphism of gene 5-HT2A may be associated with mean life span because diseases and behaviors related to this polymorphism, such as schizophrenia, suicide, aggression, and ... See full document

... the gene HTR2A, is a G-protein coupled excitatory receptor exerting its influence through the activation of secondary messengers phospholipase C and D ...cells of the prefrontal cortex, where it is ... See full document

... results of our studies in suicidal behavior include a replication of an association between suicidal behavior and a polymorphism in the serotonin transporter gene ... See full document

... genomic of drug addiction is one of the fields most investigated in the Brazilian ...States of São Paulo and Rio Grande do ...Program of Genetics and Pharmacogenetics (PROGENE) at the ... See full document

... The serotonin transporter gene is of particular interest because the magnitude and duration of serotonergic activity is regulated mainly by the serotonin transporter ... See full document

... opment of Alzheimer’s disease (AD), the most common form of dementia in the ...forms of AD while the e4 allele of the apolipoprotein E (APOE) gene (on chromosome 19) is the major ... See full document

... patterns of maternal contingent responsivity and infant attachment (Rosenblum and Paully, 1984; Jackowski et ...goal of this study was to examine amygdala vol- ume in VFD-reared and normally reared bonnet ... See full document

... control of several behavioral and physiological functions (Coiro et ...the serotonin transporter and is found in the brain, mostly in the cortex and limbic systems, which are both involved ... See full document

... birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all ...understanding of the neurobiological basis of one of mankind’s most universal and appealing ... See full document

... region of the serotonin transporter gene (SLC6A4), the G861C polymorphism (rs6296) of the serotonin receptor 1D beta (HTR1B), the T102C (rs6113) and C516T (rs6305) ... See full document

... number of subjects in this study, Type II error, through the lack of observed associa- tion between the analyzed polymorphism and T2DM, can- not be ruled ...analysis with a larger sample is ... See full document

... weeks of treatment with valsartan, the mean value of the urinary albumin to creatinine ratio was significantly reduced in the DD genotype and the ID genotype, while the changes in albuminuria in the ... See full document

... ml of the solution containing Taq DNA polymerase, stan- dard10x PCR buffer, 200 ng DNA, ...mM of each primer, 1.5mM of MgCl2 and 200 mM of dNTP mix and ...reactions with allele specific ... See full document

... no gene Tiopurina s-metiltransferase (TPMT) podem estar associados a variações individuais na resposta ao tratamento da LLA infantil, como aumento de toxicidade grave (grau 3 e ...do gene TPMT: TPMT*2 ... See full document

... µL of 7.5 M ammonium acetate and 2 µL of glycogen (10 mg/mL) to 8 µL of filtered solution, which was mixed and incubated with an equal volume of 100% ethanol for 3 h at -20 ...washed ... See full document

... frequency of genotype TT+CT of rs198977 polymorphism in patients with PCa than controls, which suggested that genotype TT+CT might increase the risk of PCa with pooled OR ... See full document

... genetic polymorphism has received con- siderable research interest in recent years because of possi- ble associations between milk protein genotypes and eco- nomically important traits in dairy ... See full document

... reproduction-related gene. In this study, the full-length cDNA sequence of the porcine SPATS2L gene was cloned through the RACE (rapid amplification of cDNA ends) ...SPATS2L gene ... See full document

... findings of our study showed association between I/D polymorphism of the ACE gene and 894T>G polymorphism of the eNOS gene and severity of EAH, presence ... See full document