[PDF] Top 20 Association of serotonin transporter gene polymorphism 5HTTVNTR with osteoporosis
Has 10000 "Association of serotonin transporter gene polymorphism 5HTTVNTR with osteoporosis" found on our website. Below are the top 20 most common "Association of serotonin transporter gene polymorphism 5HTTVNTR with osteoporosis".
Association of serotonin transporter gene polymorphism 5HTTVNTR with osteoporosis
... 5HTT gene, one located within intron 2 (5HTTVNTR) and the other in the promoter (5HT- ...For 5HTTVNTR we used the primers 5’GTCAGTATCACAGGCTGC - GAG3’ and 5’TGTTCCTAGTCTTACGCCAGTG3’ and the ... See full document
6
The polymorphism of the serotonin-2A receptor T102C is associated with age
... T102C polymorphism of gene 5-HT2A may be associated with mean life span because diseases and behaviors related to this polymorphism, such as schizophrenia, suicide, aggression, and ... See full document
6
Polymorphism in the serotonin receptor 2a (HTR2A) gene as possible predisposal factor for aggressive traits.
... the gene HTR2A, is a G-protein coupled excitatory receptor exerting its influence through the activation of secondary messengers phospholipase C and D ...cells of the prefrontal cortex, where it is ... See full document
18
Rev. Bras. Psiquiatr. vol.32 número1
... results of our studies in suicidal behavior include a replication of an association between suicidal behavior and a polymorphism in the serotonin transporter gene ... See full document
2
A review of psychiatric genetics research in the Brazilian population
... genomic of drug addiction is one of the fields most investigated in the Brazilian ...States of São Paulo and Rio Grande do ...Program of Genetics and Pharmacogenetics (PROGENE) at the ... See full document
9
Impulsivity and the 5-HTTLPR polymorphism in a non-clinical sample.
... The serotonin transporter gene is of particular interest because the magnitude and duration of serotonergic activity is regulated mainly by the serotonin transporter ... See full document
5
The study of genetic polymorphisms related to serotonin in Alzheimer’s disease: a new perspective in a heterogenic disorder
... opment of Alzheimers disease (AD), the most common form of dementia in the ...forms of AD while the e4 allele of the apolipoprotein E (APOE) gene (on chromosome 19) is the major ... See full document
5
Early life stress and macaque annygdala hypertrophy: preliminary evidence for a role for the serotonin transporter gene
... patterns of maternal contingent responsivity and infant attachment (Rosenblum and Paully, 1984; Jackowski et ...goal of this study was to examine amygdala vol- ume in VFD-reared and normally reared bonnet ... See full document
10
Music genetics research: Association with musicality of a polymorphism in the AVPR1A gene
... control of several behavioral and physiological functions (Coiro et ...the serotonin transporter and is found in the brain, mostly in the cortex and limbic systems, which are both involved ... See full document
9
AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.
... birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all ...understanding of the neurobiological basis of one of mankind’s most universal and appealing ... See full document
10
Arq. NeuroPsiquiatr. vol.69 número2B
... region of the serotonin transporter gene (SLC6A4), the G861C polymorphism (rs6296) of the serotonin receptor 1D beta (HTR1B), the T102C (rs6113) and C516T (rs6305) ... See full document
5
Association of a serotonin transporter gene ( SLC6A4 ) 5-HTTLPR
... number of subjects in this study, Type II error, through the lack of observed associa- tion between the analyzed polymorphism and T2DM, can- not be ruled ...analysis with a larger sample is ... See full document
5
The association of ACE gene polymorphism with diabetic kidney disease and renoprotective efficacy of valsartan
... weeks of treatment with valsartan, the mean value of the urinary albumin to creatinine ratio was significantly reduced in the DD genotype and the ID genotype, while the changes in albuminuria in the ... See full document
6
Association Study of an AFF1 Gene Polymorphism (rs340630) with Iranian Systemic Lupus Erythematosus Patients
... ml of the solution containing Taq DNA polymerase, stan- dard10x PCR buffer, 200 ng DNA, ...mM of each primer, 1.5mM of MgCl2 and 200 mM of dNTP mix and ...reactions with allele specific ... See full document
6
UNIVERSIDADE FEDERAL DO PARÁ INSTITUTO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM ONCOLOGIA E CIÊNCIAS MÉDICAS
... no gene Tiopurina s-metiltransferase (TPMT) podem estar associados a variações individuais na resposta ao tratamento da LLA infantil, como aumento de toxicidade grave (grau 3 e ...do gene TPMT: TPMT*2 ... See full document
110
Association of a PIT1 gene polymorphism with growth hormone mRNA levels in pig pituitary glands
... µL of 7.5 M ammonium acetate and 2 µL of glycogen (10 mg/mL) to 8 µL of filtered solution, which was mixed and incubated with an equal volume of 100% ethanol for 3 h at -20 ...washed ... See full document
6
Association of Polymorphism rs198977 in Human Kallikrein-2 Gene (KLK2) with Susceptibility of Prostate Cancer: A Meta-Analysis.
... frequency of genotype TT+CT of rs198977 polymorphism in patients with PCa than controls, which suggested that genotype TT+CT might increase the risk of PCa with pooled OR ... See full document
6
Bovine kappa-casein gene polymorphism and its association with milk production traits
... genetic polymorphism has received con- siderable research interest in recent years because of possi- ble associations between milk protein genotypes and eco- nomically important traits in dairy ... See full document
5
Molecular cloning, sequence identification, polymorphism and association of the porcine <i>SPATS2L</i> gene
... reproduction-related gene. In this study, the full-length cDNA sequence of the porcine SPATS2L gene was cloned through the RACE (rapid amplification of cDNA ends) ...SPATS2L gene ... See full document
5
Value of Angiotensin-Converting Enzyme and Monoxide Nitrogen in Pathogenesis of Myocardium Remodeling Depending on Genes' Polymorphism of Асе (I/D) and eNOS (894T>G) in Patients with Arterial Hypertension
... findings of our study showed association between I/D polymorphism of the ACE gene and 894T>G polymorphism of the eNOS gene and severity of EAH, presence ... See full document
11
temas relacionados