[PDF] Top 20 Receptor Tyrosine Kinases interactions in human cancers
Has 10000 "Receptor Tyrosine Kinases interactions in human cancers" found on our website. Below are the top 20 most common "Receptor Tyrosine Kinases interactions in human cancers".
Receptor Tyrosine Kinases interactions in human cancers
... currently in use to treat non-small cell lung carcinoma (NSCLC) patients, like Gefitinib (Iressa) and Erlotinib (Tarceva), or in clinical ...used in combination with standard cancer therapies (Guo et ... See full document
68
Structure-based network analysis of activation mechanisms in the ErbB family of receptor tyrosine kinases: the regulatory spine residues are global mediators of structural stability and allosteric interactions.
... tight interactions seen in the autoinhibited form of EGFR-WT and may reduce the energetic cost of inducing the active ...aC-helix. In contrast, inactivating kinase mutations often target ... See full document
46
The human cytomegalovirus UL11 protein interacts with the receptor tyrosine phosphatase CD45, resulting in functional paralysis of T cells.
... require interactions in cis with other raft components ...present in lipid ...result in dephosphorylation of the active site tyrosine 394 of Lck and potentially of Lck substrates such ... See full document
15
hSulf-1 gene exhibits anticancer efficacy through negatively regulating VEGFR-2 signaling in human cancers.
... VEGF receptor (VEGFR) are involved in hSulf-1-mediated suppression of cancer cells ...angiogenesis in most human ...transmembrane tyrosine kinase receptors that regulate the formation ... See full document
9
Protein tyrosine kinases in Schistosoma mansoni
... mansoni receptor kinase) signalling ...TGF-β receptor (transforming growth fac- tor beta receptor family), possibly participating in the host response to growth factors such as: cell ... See full document
8
CBL is frequently altered in lung cancers: its relationship to mutations in MET and EGFR tyrosine kinases.
... [3,10,11,12]. In addition, the proline-rich region of c-CBL can associate with the SH3 domain of Grb2, which can indirectly recruit c-CBL to RTKs via the GRB2 adaptor protein ...the tyrosine kinase SRC, ... See full document
10
Accelerated Axonal Loss Following Acute CNS Demyelination in Mice Lacking Protein Tyrosine Phosphatase Receptor Type Z
... Protein tyrosine phosphatase receptor type Z (Ptprz) is widely expressed in the mammalian central ner- vous system and has been suggested to regulate oligodendrocyte survival and ...We in- ... See full document
6
Chemokines in Homeostasis and Cancers
... niches in which stromal cells secrete high levels of CXCL12, suggesting that CXCL12 main- tains immature and terminally differentiated B-cell types in the marrow ...SDF-1 in- duced primary myeloma ... See full document
12
Distribution of Hypoxia-Inducible Factor-1α and Glucose Transporter-1 in Human Tongue Cancers
... glycolysis in cancer, in particular, those involving the activation of oncogenes and/or inactivation of tumor suppressor genes that affect glycolytic ...result in the loss of function of succinate ... See full document
8
Synergistic interactions between HDAC and sirtuin inhibitors in human leukemia cells.
... role in mitochondrial permeability transition pore formation and is also an established target of SIRT1’s anti-apoptotic activity ...levels in VA-treated Jurkat cells (Figure 3B, ...amounts in U937 ... See full document
12
Receptor-mediated endocytosis of α-galactosidase A in human podocytes in Fabry disease.
... selected in medium containing 150 m g/ml ...cultured in 24-well plates (Nagle Nunc International, Hereford, UK) with or without cover slips for uptake studies, and in 75 cm 2 culture flasks (Corning ... See full document
11
Signaling via class IA Phosphoinositide 3-kinases (PI3K) in human, breast-derived cell lines.
... role in EGF-stimulated phosphorylation of PKB in MCF10a cells. In MCF10a cells both mRNA-seq and immuno-blots indicate that p110a is not differentially highly expressed compared to related cell ... See full document
16
Socio-hydrology: conceptualising human-flood interactions
... incentive to move in that direction and by the ability to move. With M(t) [.] we indicate the awareness to flood risk based on experience/memory of prior events at time t (see Eq. 4d). High M leads people (or ... See full document
22
Erythropoietin receptor expression is a potential prognostic factor in human lung adenocarcinoma.
... expressed in non-hematopoietic tissues suggesting that EPO has pleiotropic effects extending well beyond ...expressed in various cancer cell lines (including NSCLC) and in human tumor tissues ... See full document
9
Interactions between surround suppression and interocular suppression in human vision.
... suppression. In this experiment, the center target was blended into the center ...presented in the same eye and overlay suppression was expected to ...threshold in the monocular parallel surround ... See full document
8
Interactions between schistosomiasis and human immunodeficiency virus in Western Kenya
... script in preparation). If helminth infections promote in- creased plasma viral loads, this could in turn result in greater shedding of infectious virus into mucosal secre- tions, thus ... See full document
4
Computer Modeling of Human Delta Opioid Receptor
... done in order to determine the key amino acid positions in the receptor, which are responsible for their ...investigators in that field, because theoretical models have not been published ... See full document
12
Met receptor tyrosine kinase signaling induces secretion of the angiogenic chemokine interleukin-8/CXCL8 in pancreatic cancer.
... Met receptor tyrosine kinase is one candidate implicated in pancreatic ...expressed in up to 80% of invasive pancreatic cancers but not in normal ductal cells correlating with ... See full document
13
Glycomic analysis of gastric carcinoma cells discloses glycans as modulators of RON receptor tyrosine kinase activation in cancer
... present in the sample. The supernatant was purified using in-house packed staged tips with a mixture of Poros R2 and Oligo R3 reversed phase resins (Applied Biosystem, Foster City, CA, ...inserted in ... See full document
30
Therapeutic potential and challenges of targeting receptor tyrosine kinase ROR1 with monoclonal antibodies in B-cell malignancies.
... of human ROR1 (amino acids 51–147) was PCR- amplified with primers 5-H-Fc-ROR1ig (gagaagcttgtctccgggtgcc- gaactcaacaaagattcttacctgac) and 3-X-Fc-ROR1ig (gagctcgagt- taaaacaagactccagtggaagaaacc) using ROR1 isoform ... See full document
15
temas relacionados