Low-stringency single-specific-primer PCR as a tool for detection of mutations in the rpoB gene of rifampin-resistant Mycobacterium tuberculosis

JOURNAL OFCLINICALMICROBIOLOGY, July 2003, p. 3384–3386 Vol. 41, No. 7 0095-1137/03/$08.00⫹0 DOI: 10.1128/JCM.41.7.3384–3386.2003

Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Low-Stringency Single-Specific-Primer PCR as a Tool for Detection of

Mutations in the

rpoB

Gene of Rifampin-Resistant

Mycobacterium tuberculosis

Wania S. Carvalho,

_{* Silvana Spindola de Miranda,}

_{Ka´tia M. Costa,}

_{Jose´ G. V. C. Arau}

_´jo,

Claudio J. Augusto,

_{Joa˜o B. Pesquero,}

_{Jorge L. Pesquero,}

_{and Maria A. Gomes}

Departamento de Farma´cia Social, Faculdade de Farma´cia,1Faculdade de Medicina,2and Instituto de Cieˆncias Biolo´gicas,3 Universidade Federal de Minas Gerais, and Fundac¸a˜o Ezequiel Dias, Belo Horizonte,4Minas Gerais, and Escola

Paulista de Medicina, Universidade Federal de Sa˜o Paulo, Sa˜o Paulo,5Brazil

Received 4 September 2002/Returned for modification 6 November 2002/Accepted 23 March 2003

By the low-stringency single-specific-primer PCR technique, a highly sensitive and rapid method for diag-nosis of rifampin resistance inMycobacterium tuberculosiswas established. Seven rifampin-resistant and five rifampin-susceptible specimens were analyzed. Rifampin resistance was determined by MIC measurement. A complex electrophoretic pattern consisting of many bands was obtained for both susceptible and rifampin-resistant isolates. The same pattern was obtained for all of the susceptible specimens, but differences between resistant and susceptible isolates were found. DNA sequencing showed that a particular mutation produces a specific electrophoretic pattern.

Tuberculosis has an extraordinary impact on the economies of developing countries since the disease generally strikes in-dividuals in their prime working years. Resistance of Mycobac-terium tuberculosisto antituberculosis drugs is a conspicuously large public health problem that has caused considerable dis-tress in the involved community. As important as the treatment of an infectious disease is correct diagnosis of the resistance of the pathogen in the patient to be treated. Incorrect treatment may turn the patient into a source of dissemination of a resis-tant strain (6). Rifampin resistance is conferred by mutations in the rpoB gene, which encodes the beta subunit of RNA polymerase, an oligomeric enzyme responsible for RNA syn-thesis (13, 14). Resistance in approximately 95% of rifampin-resistant isolates is due to mutations in a 69-bp region of the

rpoBgene, corresponding to codons 511 to 533, making this a good target for molecular genotypic diagnostic methods (11). The mechanism of resistance in the remaining 5% is still un-determined, with the exception of further mutations at codons 381 (8), 481 and 509 (5), and 505 (4) of therpoBgene. Point mutations within the 69-bp region of therpoBgene involving codons Ser-531, His-526, Gly-513, and Asp-516 have been shown to lead to high-level resistance inEscherichia coliandM.

tuberculosis(2, 9, 10, 12, 13). Current methods for drug sus-ceptibility testing ofM.tuberculosisin primary specimens can take up to 8 weeks. The rapid detection of drug-resistantM.

tuberculosisin clinical specimens by molecular techniques has been tried (4, 5, 9, 10, 11, 12, 13) and may be a rational and specific method to become popular in the future.

The low-stringency single-specific-primer PCR (LSSP-PCR) is an extremely simple technique that permits detection of

single or multiple mutations in gene-sized DNA fragments (7). Two PCR steps are necessary. The first is a specific PCR (sPCR) to obtain the DNA template to be used in the second one, the LSSP-PCR, which uses low-stringency conditions and only one primer, usually one of the two primers used in the sPCR. In this study, we used the LSSP-PCR to detect muta-tions in therpoBgene ofM.tuberculosisisolates. We studied seven rifampin-resistant and five rifampin-susceptible M. tu-berculosis isolates, of which four were from the sputum of patients in Minas Gerais, Brazil, with pulmonary tuberculosis and one was susceptible reference strain H37Rv. MIC deter-mination (3) was performed for all of theM.tuberculosis iso-lates tested (0.06 to 64␮g/ml) (Table 1). The sPCR was carried out with primers RIF5 (GGCAACCGCCGCCTGCGTACG) and RIF3 (GCGGTACGGCGTTTCGATGAA). These prim-ers were established to encompass the entire codified protein sequence (10) (GenBank accession number L05910). DNA was extracted from isolates with Trizol reagent (Life Technol-ogies) in accordance with the protocol of the manufacturer.

* Corresponding author. Mailing address: Departamento de Farma´-cia SoFarma´-cial, Faculdade de Farma´Farma´-cia, Universidade Federal de Minas Gerais, Av. Olega´rio Maciel, 2360, 30180-112, Belo Horizonte, MG, Brazil. Phone: 55-31-3499-2942. Fax: 55-31-3339-7685. E-mail: wscarv @icb.ufmg.br.

TABLE 1. Rifampin MICs for theM. tuberculosisisolates used in this study

Isolate MIC (␮g/ml) Phenotype

EB657 0.250 Susceptible

MO126 0.125 Susceptible

JU466a _{0.125 Susceptible}

LGP726 0.250 Susceptible

EFP041a

⬎64 Resistant

AVF001 ⬎64 Resistant

ARJ254 ⬎64 Resistant

WSJ225 32 Resistant

IAS131a

⬎64 Resistant

AGO247 32 Resistant

DES219 32 Resistant

a_{DNA was purified from cells cultivated for 3 or 4 weeks at 37°C in} Lowen-stein-Jensen medium. For the other isolates, DNA was extracted from cells isolated from sputum.

The reaction mixture consisted of 10 ng of purified mycobac-terial DNA, 0.3 U of Taq DNA polymerase (Promega), 10 pmol of each primer, 200␮M deoxynucleoside triphosphates, 50 mM KCl, 1.5 mM MgCl2, and 0.1% Triton X-100 in 10 mM Tris-HCl buffer (pH 9.0) in a final volume of 10 ␮l. This reaction mixture was subjected to 30 cycles of amplification consisting of 1 min each of denaturation at 94°C, annealing at 70°C, and elongation at 72°C. Reaction products were run in a 1% agarose gel stained with ethidium bromide, and the specific 432-bp band was excised from the gel and purified with the QIAEX II gel extraction kit (Qiagen, Hilden, Germany). Prim-ers RIF3 and RIF5 were tested in initial experiments for the LSSP step. Primer RIF3 was selected for use because it showed

a major differentiation between resistance and susceptibility. The LSSP-PCR was carried out with a volume of 10␮l of 10 mM Tris-HCl (pH 9.0) containing 25 pmol of primer RIF3, 200

␮M deoxynucleoside triphosphates, 1.0 U ofTaqpolymerase (Promega), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, and 15 ng of template DNA obtained in the sPCR and purified from agarose gel. Amplification was achieved with 39 cycles as previously described (1). Products were analyzed by polyacryl-amide gel electrophoresis and stained with silver salts (Fig. 1). The same electrophoretic pattern was observed for all suscep-tible isolates, but differences between rifampin-resistant and -susceptible isolates were found. Alternatively, the 432-bp frag-ment was cloned for sequencing. No mutation was detected in the rpoB fragment from all of the sensitive isolates, whose DNA sequence was identical to that previously published for this fragment (10). DNA sequencing of resistant isolates WSJ225, IAS131, and EFP041 confirmed mutations within the 69-bp region in codon 526 or 531 (Fig. 2 and Table 2). The electrophoretic profiles of isolates IAS131 and EFP041 were very similar, and their DNA sequences were identical. It seems that a particular mutation gives a specific electrophoretic pat-tern.

Taking into account that the subunits of RNA polymerase are conserved among prokaryotes (2), our results, demonstrat-ing electrophoretic pattern differences between the DNAs of sensitive and rifampin-resistant isolates extracted directly from sputum, make LSSP-PCR a very promising tool for the diag-nosis of antituberculosis drug resistance. It seems that the electrophoretic pattern, rather than band intensity, must be considered to define differences between isolates. However, attention must also be paid to band intensity since different fragments similar in electrophoretic migration may occur. The results obtained in our study must be validated with a great number of rifampin-resistant isolates.

This work was supported by FAPEMIG and FAPESP.

REFERENCES

1. Gomes, M. A., E. F. Silva, A. M. Macedo, A. R. Vago, and M. N. Melo.1997. LSSP-PCR for characterization of strains ofEntamoeba histolyticaisolated in Brazil. Parasitology114:517–520.

2. Jin, D. J., and C. A. Gross.1988. Mapping and sequencing of mutations in theEscherichia coli rpoBgene that lead to rifampicin resistance. J. Mol. Biol.

202:45–48.

3. Kent, P. T., and G. P. Kubica.1985. Public health mycobacteriology. A guide for the level III laboratory. Centers for Diseases Control, Atlanta, Ga. 4. Matsiota-Bernard, P., G. Vrioni, and E. Marinis.1998. Characterization of

rpoBmutations in rifampin-resistant clinicalMycobacterium tuberculosis iso-lates from Greece. J. Clin. Microbiol.36:20–23.

5. Nash, K. A., A. Gaytan, and C. B. Inderlied.1997. Detection of rifampin resistance inMycobacterium tuberculosisby use of a rapid, simple, and spe-cific RNA/RNA mismatch assay. J. Infect. Dis.176:533–536.

6. Ohno, H., H. Koga, S. Kohno, T. Tashiro, and K. Hara.1996. Relationship between rifampin MICs for andrpoBmutations ofMycobacterium tubercu-losisstrains isolated in Japan. Antimicrob. Agents Chemother.40:1053– 1056.

7. Pena, S. D. J., G. Barreto, A. R. Vago, L. De Marco, F. C. Reinach, E. Dias Neto, and A. J. G. Simpson.1994. Sequence-specific “gene signatures” can

FIG. 1. Silver-stained 5% polyacrylamide gel electrophoresis show-ing gene signatures obtained by LSSP-PCR. Lanes: 1, H37Rv; 2, EB657; 3, MO126; 4, JU466; 5, LGP726; 6, EFP041; 7, AVF001; 8, ARJ254; 9, WSJ225; 10, IAS131; 11, AGO247; 12, DES219; M, 100-bp size standard ladder; C, negative control (without DNA).

FIG. 2. DNA sequences of therpoBgenes from rifampin-sensitive

M.tuberculosisstrain H37Rv and rifampin-resistant isolates WSJ225 and EFP041. The 69-bp region of therpoB gene, corresponding to codons 511 to 533, is underlined. For the resistant isolates, only mu-tated codons are presented.

TABLE 2. Mutations observed in the 69-bp region of therpoB

gene studied

Isolate(s) Codon Mutation Amino acid change

EFP041, IAS131 526 CAC3TAC His3Tyr

WSJ225 531 TCG3TTG Ser3Leu

be obtained by PCR with single specific primers at low stringency. Proc. Natl. Acad. Sci. USA91:1946–1949.

8. Santos, F. R., S. D. J. Pena, and J. T. Epplen.1993. Genetic and population study of a Y-linked tetranucleotide repeat DNA polymorphism with a simple non-isotopic technique. Hum. Genet.90:655–656.

9. Taniguchi, H., H. Aramaki, Y. Nikaido, Y. Mizuguchi, M. Nakamura, T. Koga, and S. Yoshida.1996. Rifampicin resistance and mutation of therpoB gene inMycobacterium tuberculosis. FEMS Microbiol. Lett.144:103–108. 10. Telenti, A., P. Imboden, F. Marchesi, D. Lowrie, S. Cole, M. J. Colston, L.

Matter, K. Schopfer, and T. Bodmer.1993a. Detection of rifampicin-resis-tance mutations inMycobacterium tuberculosis. Lancet341:647–650. 11. Telenti, A., P. Imboden, F. Marchesi, T. Schmidheini, and T. Bodmer.1993b.

Direct, automated of rifampin-resistantMycobacterium tuberculosisby

poly-merase chain reaction and single-strand conformation polymorphism anal-ysis. Antimicrob. Agents Chemother.37:2054–2058.

12. Watterson, S. A., S. M. Wilson, M. D. Yates, and F. A. Drobniewski.1998. Comparison of three molecular assays for rapid detection of rifampin resis-tance inMycobacterium tuberculosis. J. Clin. Microbiol.36:1969–1973. 13. Whelen, A. C., T. A. Felmlee, J. M. Hunt, D. L. Williams, G. D. Roberts, L.

Stockman, and D. H. Persing.1995. Direct genotypic detection of Mycobac-terium tuberculosisrifampin resistance in clinical specimens by using single-tube heminested PCR. J. Clin. Microbiol.33:556–561.

14. Williams, D. L., C. Waguespack, K. Eisenach, J. T. Crawford, F. Portaels, M. Salfinger, C. M. Nolan, C. Abe, V. Sticht-Groh, and P. T. Gillis.1994. Characterization of rifampin resistance in pathogenic mycobacteria. Antimi-crob. Agents Chemother.38:2380–2386.