124
Figura 37: Co‐localização de decorim e MT1‐MMP em cortes de tecidos comprometidos e não comprometidos por câncer de próstata.
Amostras de tecido de regiões comprometidas ou não comprometidas por adenocarcinoma de próstata foram obtidas após a excisão da próstata de 4 pacientes (ACM, JSM, LCE e CVO). Os tecidos foram fixados com paraformaldeído 4% em PBS, desidratados com sacarose 30% em PBS e emblocados em meio de condicionamento (TissueTek). Cortes de 4 m foram coletados em laminas silanizadas e analizados por imunofluorescência com os anticorpos anti‐decorim revelado com um secundário conjugado com Alexa Fluor 594 (vermelho), e anti‐MT1‐MMP revelado com um secundário conjugado com Alexa Fluor 488 (verde). O núcleo celular foi corado por DAPI (azul) e a co‐localização dos anticorpos fornece coloração amarela. Barra de escala: 20 m.
Em 2 pacientes (JSM e CVO) houve aumento significante na expressão de MMP‐ 1 no estroma adjacente ao tecido tumoral nos tecidos comprometidos. Curiosamente, esse aumento segue o aumento de decorim, sendo as 2 moléculas co‐localizadas nas células epiteliais do lúmen glandular (Figura 37). MT1‐MMP é localizada e expressa em células que circundam as glândulas cancerosas. Esta enzima está provavelmente envolvida na invasão do tumor, relacionando‐se a um estado mais avançado do tumor, nos 2 tecidos analisados. Assim, como o aumento na expressão de decorim segue o aumento na expressão da MMP‐1, o decorin poderia indicar tumores em estado avançado.
Os 2 pacientes (JSM e CVO) que apresentaram um aumento significante de MMP‐1 e decorim também apresentaram aumento significante na expressão de TGFβ, observado tanto por imunofluorescência quanto por qPCR (Figura 38). Estes dados corroboram com a possibilidade destes 2 pacientes apresentarem estágios mais avançados de câncer de próstata. O aumento da expressão de TGFβ já foi descrito em câncer de próstata. Os demais pacientes apresentaram aumento de TGFβ, menos expressivo: o tecido comprometido apresentou um aumento de expressão 1‐2 vezes maior quando comparado ao tecido não comprometido do mesmo paciente (ACM e LCE). Nos 2 pacientes (JSM e CVO) que apresentaram uma grande aumento na expressão decorim, MT1‐MMP e TGFβ no tecido comprometido, foi observado também uma maior expressão de TGFβ em seus controles não comprometidos, quando comparado aos tecidos não comprometido dos demais pacientes (Figura 38). Assim, pode‐se inferir que, num estado mais avançado de câncer de próstata, existe um aumento significante de TGF‐β por todo o tecido prostático.
A expressão de biglicam não apresentou um padrão de aumento ou diminuição entre os tumores, quando comparado ao tecido não comprometido. Em apenas um dos pacientes, que aparentemente apresenta câncer de próstata mais agressivo (JSM), observou‐se aumento significante na expressão de biglicam localizado nas células epiteliais do lúmen glandular (Figura 38). O biglicam apresentou‐se co‐localizado com o TGFβ nas células epiteliais do lúmen do tecido. Sabe‐se que os membros da família
126 dos SRLPs, como por exemplo, o biglicam, se ligam ao TGFβ, podendo apresentá‐lo ao seu receptor. Este mesmo paciente apresentou um maior aumento relativo de expressão de fibromodulina quando comparado aos demais pacientes (Figura 26).
128 Figura 38: Co‐localização de TGF‐ e biglicam em cortes de tecidos comprometidos e não comprometidos por câncer de próstata.
Amostras de tecido de regiões comprometidas ou não comprometidas por adenocarcinoma de próstata foram obtidas após a excisão da próstata de 4 pacientes (ACM, JSM, LCE e CVO). Os tecidos foram fixados com paraformaldeído 4% em PBS, desidratados com sacarose 30% em PBS e emblocados em meio de condicionamento (TissueTek). Cortes de 4 m foram coletados em laminas silanizadas e analizados por imunofluorescência com os anticorpos anti‐TGF‐ revelado com um secundário conjugado com Alexa Fluor 594 (vermelho), e anti‐biglicam revelado com um secundário conjugado com Alexa Fluor 488 (verde). O núcleo celular foi corado por DAPI (azul) e a co‐localização dos anticorpos fornece coloração amarela. Barra de escala: 20 m.
Lumicam, decorim, fibromodulina, TGF‐β e MMP‐1 foram detectados no citoplasma de células circundantes do lúmen das glândulas secretoras de tecido prostático normal. Entretanto, não foi possível estabelecer um padrão comum de expressão destas moléculas pelas células secretoras do lúmen das glândulas nos tecidos comprometidos ou não comprometidos por adenocarcinoma de próstata. A fibromodulina, o decorim e o TGFβ foram imunodetectados no citoplasma das células secretoras do lúmen em todos os tecidos prostáticos analisados, existindo uma variabilidade na quantidade expressa entre as amostras comprometidas e não comprometidas. O lumican foi imunodetectado no citoplasma das células secretoras do lúmen do tecido prostático normal, ou seja, não comprometido, no entanto também foi encontrado no tecido comprometido de um paciente (JSM).
As linhagens celulares de câncer de próstata, PC3 e DU 145 não expressam lumicam e expressam baixas quantidades de fibromodulina. Comparando os dados obtidos dos tecidos prostáticos com aqueles obtidos das linhagens estabelecidas de câncer de próstata, é possível que o aumento detectado por qPCR obtido do tecido prostático seja na realidade reflexo de aumento na expressão de lumicam, sintetizada por outros tipos celulares e não pelas células tumorais. A exemplo do que ocorre no câncer de mama, lumicam é secretado por fibroblastos adjacentes ao tumor, mas não pelas células tumorais (Leygue, 2000; Leygue, 1998). Isso correlacionaria muito bem com a localização estromal do lumicam, obtido por imunohistoquímica, principalmente circundando as células epiteliais prostáticas, sugerindo certo grau de fibrose, composto provavelmente de colágeno e lumicam, e sintetizados pelos fibroblastos.
A reação desmoplástica foi muito bem caracterizada no câncer de pâncreas (Köninger, 2004). Consiste de uma forte reação fibrótica ao redor do tecido tumoral, e supostamente, uma reação do hospedeiro ao crescimento tumoral. Os miofibroblastos são a principal fonte para a produção excessiva deste tecido fibrótico, que consiste principalmente de colágeno tipos I e IV, além de uma variedade de proteínas da MEC.
130 Os SLRPs tem sido identificados como moduladores da fibrose e crescimento tumoral e os nossos dados sugerem também para o lumicam um papel na reação do hospedeiro à invasão tumoral.
4.4 Contato célula-célula entre células de câncer coloretal e fibroblastos induz acúmulo de matriz extracelular afetando a invasão da célula tumoral
132 RESUMO
Miofibroblastos são fibroblastos ativados que se caracterizam pela expressão de actina de célula muscular lisa (actina α) e são encontrados circundando tumores possuindo papel crucial na reação desmoplástica. Esses miofibroblastos sintetizam colágenos e outras proteínas constituintes da matriz extracelular (MEC), como proteoglicanos. O proteoglicanos pequenos ricos em leucina (SRLPs), como o lumicam, decorim, biglicam e fibromodulina foram identificados circundando tumores de pancreáticos e de mama. A presença de SLRPs em tecidos fibrosos circundando células de câncer, e sua capacidade de suprimir sua proliferação é atualmente discutida. Essa acumulação de matriz extracelular circundando tumores afeta diretamente o crescimento e invasão das células de câncer, tornando a compreensão dos processos envolvidos na formação do tecido fibrótico de vital importância. Foi realizado o estudo das interações entre células de câncer coloretal (Caco-2 e HCT116) e fibroblastos pelo sistema de co-cultura de células. Foi demonstrado que o contato direto célula-célula entre fibroblastos e células de câncer coloretal é necessário para a indução da expressão de componentes de matriz (colágeno I, colágeno III, colágeno IV, colágeno V, biglicam e fibromodulina) pelos fibroblastos. Ainda, a exposição de fibroblastos a fatores solúveis produzidos por células de câncer coloretal diminuem a expressão de componentes de MEC. Os miofibroblastos circulantes também expressam proteases, incluindo as metaloproteinases de matriz (MMPs). A produção desses componentes resulta no remodelamento da MEC, podendo estimular o crescimento e migração das células de câncer. Ainda, os miofibroblastos induzem a expressão de MMPs quando expostos a fibroblastos. A importância do contado direto célula-célula entre as células de câncer coloretal e fibroblastos no acúmulo de MEC que circunda o tumor foi demonstrado.
Colorectal cancer desmoplastic reaction affects tumor cell invasion
Vivien J. Coulson-Thomas*, Yvette M. Coulson-Thomas*, Tarsis F. Gesteira*, Ana M. Mader†, JaquesWaisberg‡, Maria A. Pinhal*#, Andreas Friedl§, Helena B.
Nader*, LenyToma*
*Department of Biochemistry, Universidade Federal de São Paulo, São Paulo, SP,
Brazil; †Department of Pathology, Faculdade de medicina ABC, Santo Andre, SP,
Brazil; ‡Department of Gastrosurgery, Faculdade de Medicina ABC, Santo Andre, SP,
Brazil; #Department of Biochemistry, Faculdade de Medicina ABC, Santo Andre, SP,
Brazil; §Department of Pathology and Laboratory Medicine, University of
Wisconsin-Madison, Madison WI, 53792, USA
Abbreviations: (sm), smooth muscle; (ECM), extracellular matrix; (SRLP), small leucine-rich proteoglycans, stromal reaction.
Key words: myofibroblasts, stromal reaction, proteoglycans, collagen, extracellular matrix, 2-D and 3D-cultures
Running Title: Desmoplasia affects colorectal tumor cell invasion
Address all correspondence to: Dr.Vivien J. Coulson-Thomas, Departamento de Bioquímica, Escola Paulista de Medicina, Universidade Federal de São Paulo, Rua 3 de Maio, 100 - CEP 04044-020, São Paulo, SP, Brazil. Tel: +55(11)5579-3175; FAX: +55(11)5573-6407; E-Mail: coulson.thomas@unifesp.br
134 Abstract
During cancer cell growth many tumors exhibit various grades of desmoplasia, unorganized production of fibrous or connective tissue, composed mainly of collagen fibers and myofibroblasts. The accumulation of extracellular matrix (ECM) surrounding tumors directly affects cancer cell proliferation, migration and spread, therefore the study of desmoplasia is of vital importance. Myofibroblasts synthesize an amalgam of products including collagens and other ECM proteins, such as proteoglycans and are activated during a desmoplastic reaction. Small leucine rich proteoglycans have been characterized surrounding breast and pancreatic tumors and have the ability to suppress cell proliferation. In this study we have analyzed desmoplasia co-cultivating colorectal cancer cells (Caco-2 and HCT116) and myofibroblasts using various co-culture systems. Our findings demonstrate that direct cell-cell contact between myofibroblasts and colorectal cancer cells evokes an up-regulation of the expression of ECM components (collagen I, collagen III, collagen IV, collagen V, biglycan and fibromodulin) by myofibroblasts. The ECM accumulation produced when myofibroblasts are co-cultivated with colorectal cancer cells appears unorganized and in bundles. This ECM accumulation slowed the migration and invasion of the colorectal tumor cells in both monolayer and 3-D co-culture systems. The participation of the ECM components analyzed in this study in desmoplasia is also demonstrated in vivo in human colorectal carcinoma tissue, validating our in vitro system.
Introduction
During cancer cell growth many tumors exhibit various grades of desmoplasia, unorganized production of fibrous or connective tissue, composed mainly of collagen fibers and fibroblasts, which affects cancer cell proliferation, migration and spread [1]. Desmoplastic reactions have been associated with invasive adenocarcinomas of breast and ovaries, gastrointestinal tract, and in the lung excluding small cell lung cancers, and also frequently described in squamous cell carcinomas and bilio-pancreatic carcinomas, although the prognostic significance of desmoplasia is still debated [1].The fibrotic deposition is produced mainly by stromal cells, principally fibroblasts [1, 2]. Myofibroblasts, activated fibroblasts characterized by the expression of smooth muscle (sm) α-actin, are found surrounding tumors and play an intricate role in this desmoplastic reaction. These myofibroblasts synthesize collagens, such as, collagens I, III and IV and proteoglycans which constitute the bulk of the desmoplastic reaction [3-6]. Myofibroblasts in the reactive stroma surrounding human colon adenomas and carcinomas synthesize extracellular matrix (ECM) components such as fibronectin and tenascin [7]. Fibronectin, tenascin, and chondroitin sulfate proteoglycans have been documented as the major components of colorectal adenoma and carcinoma stroma, whereas laminin, collagen IV, and heparan sulfate proteoglycans are down-regulated [8]. The expression of small leucine-rich proteoglycans (SRLPs), such as lumican, decorin, biglycan and fibromodulin, has been demonstrated surrounding breast, pancreatic and colon tumors [9-13]. Decorin and fibromodulin bind collagen types I and II [14, 15] and decorin has been shown to be essential for proper collagen fibrillogenesis [16, 17]. Heterologous expression of decorin has been shown to suppress tumor formation in vivo and retard the growth of colon cancer cells in vitro [18] through
136 modulating growth factor activity and ECM assembly. In accordance, decorin-deficient mice spontaneously develop intestinal tumors. Decorin expression is down-regulated in fibroblast-like cells within or immediately adjacent to human breast tumors [10]. Lumican expression, on the other hand, is up-regulated in fibroblast-like cells within the stroma surrounding human breast tumors compared to adjacent normal stroma [9] and has been associated with poor patient prognosis in advanced colorectal cancer [13]. Biglycan is over-expressed in the ECM of pancreatic tumors compared to normal pancreatic tissue and has been shown to inhibit the growth of pancreatic tumor cells [19].
Carcinoma cells have the capacity to induce normal fibroblasts to the reactive myofibroblast phenotype [20, 21]. In vitro studies have shown that transforming growth factor beta 1 (TGFβ1) stimulates the phenotypic switching of fibroblasts to myofibroblasts and regulates the expression of ECM components [22]. Therefore, myofibroblasts play a key role in cancer progression.
Emphasis in cancer research is given to the study of oncogenic events in the tumor cells, however, increasing evidence sheds light on the important role stromal cells play in tumor development. In vitro studies have shown that colon carcinoma cells produce soluble factors that stimulate the synthesis and secretion of proteoglycans by normal colon fibroblasts [23]. Many studies have focused on features of the stromal-cancer interactions leading to desmoplasia in pancreatic cancer; however, events involved in colorectal cancer desmoplastic reaction remain to be elucidated. Moreover, the physiological implications of this desmoplastic reaction remain to be fully established. In this study we established a desmoplastic reaction in 2-D co-culture systems between
colorectal cancer cell lines and fibroblasts using bi-layer and O-ring co-cultures. We examined components of the ECM, such as collagens (collagen types I, III, IV and V) and SLRPs (decorin, biglycan, lumican and fibromodulin) in order to characterize the desmoplastic reaction. The presence of these ECM components in the in vitro desmoplastic reaction is also demonstrated in vivo in colorectal carcinoma, thereby, validating our systems. Thereafter, we established and characterized a desmoplastic reaction using 3-D co-culture systems. We further elucidated whether the accumulation of ECM restricts or induces the migration of colorectal cancer cells through the surrounding stroma in both 2- and 3-D co-culture systems.
138 Materials and Methods
Cell culture
Cancer cell lines isolated from primary colorectal tumors, Caco-2 and HCT 166, were purchased from ATCC (HTB-37 and CCL-247, respectively) and maintained in DMEM medium (GibcoBRL, Life Technologies Inc., Grand Island, NY)/10% fetal bovine serum (FBS; Cultilab, Campinas, Brazil), containing 2 mM L-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin (all from Invitrogen, Carlsbad, CA), or RPMI medium (GibcoBRL)/10% FBS, containing 2 mM L-glutamine, 100 units/ml penicillin and 100 g/ml streptomycin, respectively, at 37C in a 5% CO2 humidified environment. Human primary cultures of fibroblasts isolated from amniotic fluid (WPF5) were kindly donated by Prof. Walter Pinto Jr. and used between passages 3 and 6. Fibroblasts often transform to a myofibroblastic-like state when placed in culture, which was characterized by the presence and organization of sm actin (results not shown). The cells were maintained in DMEM medium/10% FBS, containing 2mM L-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin, at 37C in a 5% CO2 humidified environment. All experiments were previously approved by the University Ethics Committee (0038-08) according to national and international guidelines. Informed consent was obtained from all women prior to collection of the amniotic fluid as recommended by national guidelines and the Declaration of Helsinki.
Heterotypic co-culture bilayer system
Fibroblasts or colorectal cancer cells were removed from P100 culture dishes (Corning) with trypsin/EDTA (GibcoBRL), washed in EBSS, and then seeded at a density of 3 x 106 cells per well (6 well polystyrene culture dishes, Corning, Corning
Incorporated, Corning, NY) in DMEM or RPMI containing 10% FBS, L-glutamine/penicillin/streptomycin. The cells were maintained in culture for 24 h at 37C in a 5% CO2 humidified environment, and then either fibroblasts or colorectal cancer cells were seeded on top, at a cell density of 6 x 106 cells per well and maintained in culture for a further 24 h at 37C in a 5% CO2 humidified environment, and then total RNA extracted (see below). Experimental groups consisted of seeding fibroblasts underneath and colorectal cancer cells on top at different ratios (CACO2/WPF5, HCT116/WPF5) and vice versa (WPF5/CACO2, WPF5/HCT116). Control groups consisted of seeding the same cell type underneath and on top (WPF5/WPF5, CACO2/CACO2, HCT116/HCT116).
Bi-compartmental co-culture system
Culture plate inserts pore size 0.4 µm (30 mm, Millicell®-PCF, Millipore Corp., Bedford, MA) were placed one per well (6 well polystyrene culture dishes) in RPMI or DMEM containing 10% FBS, L-glutamine/penicillin/streptomycin, and left for 20 min in a sterile atmosphere (flow hood). Fibroblasts or colorectal cancer cells were removed from P100 culture dishes with trypsin/EDTA (GibcoBRL), washed in EBSS, and then seeded at a density of 3 x 106 cells per well in the bottom compartment of the insert co-culture system. The cells were maintained in co-culture for 24 h at 37C in a 5% CO2 humidified environment. Fibroblasts or colorectal cancer cells were then seeded in the top compartment of the insert co-culture system at a density of 3 x 106 cells and incubated for a further 24 h (37C, 5% CO2). Total RNA was extracted from the bottom compartment (see below). Experimental groups consisted of seeding fibroblasts in the bottom compartment and colorectal cancer cells in the top compartment
140 (CACO2/WPF5, HCT116/ WPF5) and vice versa (WPF5/CACO2, WPF5/HCT116). Control groups consisted of seeding the same cell type in the top and bottom compartments of the insert co-culture system (WPF5/WPF5, CACO2/CACO2, HCT116/HCT116).
RNA extraction and real-time reverse transcription-PCR analysis
Total RNA was isolated from fibroblasts and colorectal cancer cells after a co-culture of 24 h using Trizol® Reagent (Invitrogen, Carlsbad, CA). The concentration and purity of the RNA in each sample was determined using a spectrophotometer at 260 and 280 nm. First strand cDNA was reverse transcribed using 1 g of total RNA and the
kit Improm IITM Reverse Transcriptase (Promega, Madison, WI), according to the manufacturer’s protocol. Real time PCR amplification was performed on 2l of the cDNA (1:5) with specific primers for collagen types I, III, IV and V, fibromodulin, lumican, decorin, biglycan and the kit SYBR Green Master Mix (Applied Biosystems, Foster City, CA) in a 7500 Real-Time PCR System (Applied Biosystems, Warrington, UK), using the activation cycle of 95C for 10 min, 40 cycles of 95C for 15 sec (denaturation stage), 61C for 1 min (annealing and elongation stage) and 72C for 30 sec. The specificity of the amplified products was analyzed through dissociation curves generated by the equipment yielding single peaks. Negative controls were used in parallel to confirm the absence of any form of contamination in the reaction. Analysis of the data was carried out using the 2-∆∆Ct method [24] using the 7500 Real-Time PCR System’s software. The primer combination used for collagen I was forward:
5´AGTGTGGCCCAGAAGAACTGGTACAT3´ and reverse: 3´TCGAACTGGAATCCATCGGTCATGCT5´; for collagen III, forward:
5’TGCATACATGGATCAGGCCAGTGGAA3’ and reverse: 3’TTCGTGCAACCATCCTCCAGAACTGT5’; for collagen IV, forward:
5’TGGAGGAGTTTAGAAGTGCGCCAT3’ and reverse: 3’AGGCTTCTTGAACATCTCGCTCCT5’; for collagen V, forward:
5’TGCTCCAGGGATTCCTTCAAGGTT3’ and reverse: 3’ATAGGAGAGCAGTTTCCCACGCTT5’; for fibromodulin, forward:
5’TTCCCTCCCGCATGAAGTATGTGT3’ and reverse: 3’TATCACTGGTGATCTGGTTGCCGT5’; for lumican, forward:
5’TGGCATTGATTGGTGGTACCAGTG3’ and reverse: 3’TGGGTAGCTTTCAGGGCAGTTACA5’; for decorin, forward:
5’GCTGGACCGTTTCAACAGAGA3’ and reverse: 3’GGGGAAGATCCTTTGGCACT5’; for biglycan, forward:
5’TTGGACAACAACAAGTTGGCCAGG3’ and reverse: 3’TGAAGAGGCTGATGCCGTTGTAGT5’. Expression values were normalized to
the housekeeping gene ribosomal protein S29 (RPS29) using the primer combination forward: 5’CCTGGAGGAGAAGAGHAAAGAGA3’ and reverse: 3’TTGAGGACCTCTGTGTATTTGTCAA5’.
Heterotypic co-culture system using O-rings
Sterile glass cloning rings (O-rings) were placed on top of 12 mm diameter glass coverslips in 24 well polystyrene culture dishes. Fibroblasts and colorectal cancer cells were removed from P100 culture dishes with trypsin/EDTA (GibcoBR) and washed in EBSS. Fibroblasts were then seeded on the outside of the O-ring at a density of 1.5 x 104 cells per well in DMEM containing 10% FBS, L-glutamine/penicillin/streptomycin,
142 whereas colorectal cancer cells were seeded inside the O-ring at a cell density of 0.5 x 104 cells per well in RPMI containing 10% FBS, L-glutamine/ penicillin/streptomycin. The cells were maintained in culture for 48 h (37C, 5% CO2). The O-rings were then removed and the cells maintained in culture until the cells spread out into the cell-free area left by the O-ring (approximately 4 days). The cells were sequentially fixed using 4% paraformaldehyde and 1:1 methanol/acetone. The cells were stained for collagen types I, III, IV and V, fibromodulin, lumican, decorin, biglycan and -actin (see below).
Invasion assay of colorectal cancer cells through 3-D fibroblast-produced matrix
Fibroblasts were removed from P100 culture dishes (Corning) with trypsin/EDTA, washed in EBSS, and then seeded at a density of 3 x 106 cells per well (6 well polystyrene culture dishes, Corning) in DMEM or RPMI containing 10% FBS, L-glutamine/penicillin/streptomycin. The cells were maintained in culture at 37C in a 5%
CO2 humidified environment until confluent, and then either fibroblasts or colorectal cancer cells (in order to induce a desmoplastic reaction) were seeded on top, at a cell density of 1 x 105 cells per well and maintained in culture for an additional 6 days at 37C in a 5% CO2 humidified environment. After confluence the cultures were treated with 25 g/mL of ascorbic acid every other day in order to induce the production of the 3-D matrix.
Colorectal tumor cells were transfected with GFP plasmid using FuGENE®HD Transfection Reagent (Roche Applied Science, Mannheim, Germany) and maintained in culture for 24 hours and subsequently seeded into the 3-D stromagenic system. The GFP positive cells were left to migrate for 2 hours and observed using scanning confocal inverted microscope (Zeiss LSM510 Zeiss, Germany). Experimental groups
consisted of seeding colorectal tumor cells into a 3-D stromagenic system composed of fibroblasts seeded underneath colorectal cancer cells (WPF5 + CACO2, WPF5 + HCT). Control groups consisted of seeding colorectal tumor cells into a 3-D stromagenic system of solely fibroblasts (WPF5). Following the migration assay the cells were fixed with 4% paraformaldehyde and submitted to immunocytochemistry in order to verify co-localization of GFP with sm- actin and vimentin.
Immunocytochemistry and microscopy
Cells were washed 3 times in PBS (15 min each wash), and the coverslips then incubated in blocking solution (5% FBS) at room temperature for 1 h. Coverslips were then incubated with primary antibodies overnight at 4C. Primary antibodies used were: mouse monoclonal anti-collagen I (Calbiochem I-8H5, San Diego, CA, and Sigma COL1, Sigma Chemical Co., St. Louis, MI), goat anti-collagen III (Santa Cruz, Santa Cruz, CA), goat anti-collagen IV (against α1 type IV, Santa Cruz, Santa Cruz, CA), rabbit anti-collagen V (Chemicon AB763P, Chemicon International, Temecula, CA), rabbit anti-fibromodulin (Santa Cruz H-50), monoclonal mouse anti-lumican (produced at our laboratory), rabbit anti-lumican (Santa Cruz H-90), mouse anti-decorin (Seikagaku 6-B6, Seikagaku Corporation, Tokyo, Japan), rabbit anti-biglycan (Santa Cruz H-150), mouse anti-fibronectin (BD transduction laboratories), goat anti-perlecan (Santa Cruz L-20) and finally, mouse anti-smooth muscle actinconjugated with Cy3 (clone 1A4, Sigma-Aldrich, St. Louis, MI). Afterwards, the coverslips were washed 3 times in PBS and then incubated for 1 h at room temperature with appropriate fluorescent secondary antibodies conjugated to Alexa Fluor® 488 or Alexa Fluor® 594 (Molecular Probes/Invitrogen, Eugene, OR). In order to investigate the possible
co-144 localization of compounds, a second incubation with primary and secondary antibodies was performed. After incubation with the antibodies, the coverslips were washed 3 times in PBS, mounted on glass slides in Fluoromount G (2:1 in PBS, Electron Microscopy Sciences, Hatfield, PA) and sealed with nail polish. Negative control immunostaining was performed with omission of each primary antibody and did not yield specific immunostaining (not shown). Coverslips were examined using scanning confocal inverted microscope (Zeiss LSM510, Zeiss, Germany) and fluorescence quantified using LSM image browser.
Immunohistochemistry
Human colorectal adenocarcinoma tissues were obtained from 5 patients at the Hospital do Servidor Público Estadual, São Paulo, Brazil (Table 1). Normal tissues were obtained from the same patients at a distance of at least 10 cm from the tumors and histologically stated as non-neoplastic by a pathologist. Tissues were fixed for 12 h in 2 % buffered paraformaldehyde and further processed for paraffin embedding. Tissue sections 2 µm thick were cut, deparaffinized and rehydrated in PBS. Endogenous peroxidase was blocked with 3 % hydrogen peroxide in PBS for 30 min followed by blocking of unspecific protein binding sites with 5 % FBS in PBS for 30 min. Sections were then incubated with collagen I, collagen IV, collagen V, anti-biglycan and anti-fibromodulin for 16 h at 4oC in blocking solution. Sections were washed and incubated with biotin-conjugated anti-rabbit/mouse/goat antibody (Biotinilated Link Universal, DakoCytomation, Dako North America Inc., Vila RealCarpinteria, CA) for 1 h at 18oC followed by streptavidin-horseradish peroxidase, streptavidin-HRP conjugate (DakoCytomation, Dako North America Inc.). Bound HRP
was detected using diaminobenzidine-tetrahydrochloride, liquid DAB + substrate Chromogen System (Dako North America Inc.) for 15 seconds and the reaction stopped with double distilled water. The slides were counterstained with hematoxylin, mounted in Permount™ Mounting Medium (Electron Microscopy Sciences) and observed under a Nikon Eclipse E800 microscope. Negative controls were performed by omitting the primary antibody and did not yield specific signals. Tissue samples were obtained after patients consent as recommended by national guidelines and the Declaration of Helsinki and the study of human tissues was approved by the ethics committee of all institutions involved, UNIFESP (1796/08), Faculdade de Medicina do ABC (025/2008) and Hospital do ServidorPúblico (021/08).
Statistics
All values are presented as means ± standard deviation of the mean. The difference between 2 groups was compared by unpaired Mann-Whitney test. A level of p< 0.05 was considered as significant. Statistical analysis was performed with the GraphPad Prism version 5 software package (GraphPad Software, San Diego, CA).
146 Results
Gene expression of ECM components after heterotypic bilayer co-culture of colorectal cancer cells and fibroblasts
In order to elicit the steps leading to the production of fibrotic tissue surrounding many tumors, we cultured cancer cells isolated from primary colorectal carcinoma (cell lines Caco-2 and HCT 116) in direct contact with fibroblasts. We studied the expression of collagens (collagen types I, III, IV and V) and SLRPs (decorin,lumican, fibromodulin and biglycan). An increase in the expression of all the collagens analyzed as well as biglycan and fibromodulin was observed in this type of co-culture system (Figure 1). Two experimental conditions were studied: colorectal cancer cells seeded directly on top of previously seeded fibroblasts, and fibroblasts seeded directly on top of previously seeded colorectal cancer cells. Collagen I expression increased at least 2-fold and 3-fold when Caco-2 cells and HCT 116 cells were seeded on a monolayer of fibroblasts, respectively, but expression levels were not altered when fibroblasts were seeded on top of either colorectal cancer cell line (Figure 1A). Collagen III expression increased at least 5-fold in bilayer co-cultures of colorectal cancer cells plated on a monolayer of fibroblasts, independently of the colorectal cancer cell line, and approximately 2-fold in cultures where fibroblasts were cultured on a monolayer of Caco-2 cells, but no significant increases were observed when fibroblasts were cultured on a monolayer of HCT 116 cells (Figure 1B). Collagens IV and V were the ECM components with the greatest overall increase in expression when fibroblasts were cultured in cell-cell contact with colorectal cancer cells; the expression of collagen types IV and V increased over 10-fold in bilayer co-cultures of fibroblasts and colorectal cancer cells when the colorectal cancer cell was seeded on top, and approximately
5-fold when the fibroblasts were seeded on top (Figure 1C and D). Biglycan expression increased slightly and doubled when Caco-2 and HCT 116 cells were seeded on top of fibroblasts, respectively, but decreased when fibroblasts were cultured on top of colorectal cancer cells (Figure 1F). Fibromodulin expression increased at least 3-fold and almost 2-fold when Caco-2 cells and HCT 116 cells were cultured on a monolayer of fibroblasts, respectively, whereas significant increases were not observed when fibroblasts were seeded on either of the colorectal tumor cell lines (Figure 1H). The increases observed were always greater when colorectal cancer cells were seeded on top of fibroblasts compared to when fibroblasts were seeded on top of colorectal cancer cells. Slight decreases in the expression of decorin and lumican were observed in bilayer co-cultures of fibroblasts and colorectal cancer cells however these differences were not considered significant (Figure 1E and G).
With the exception of fibromodulin for both cell lines and collagen IV for Caco-2 cells, the colorectal cancer cell lines expressed no or insignificant levels of the ECM components studied here, and therefore, the expression levels observed accounted primarily for expression levels in the fibroblasts (Figure 1).
Gene expression of ECM components after bi-compartmental (transwell) co-culture of colorectal cancer cells and fibroblasts
Fibroblasts and colorectal cancer cells were cultured in a bi-compartmental (transwell) co-culture system allowing cross-talk through soluble factors between the two cell types. This allowed us to evaluate the role of soluble factors in the up-regulation of the expression of ECM components observed in the bilayer co-cultures where there is both cross-talk through soluble factors and cell-cell contact at play.
148 Distinct results were obtained when direct cell-cell contact was eliminated from the cross-talk between colorectal cancer cells and fibroblasts. When the fibroblasts were exposed solely to the soluble factors produced by the colorectal cancer cell lines Caco-2 and HCT 116, there was a general decrease in the expression of ECM components (Figure 2).
When fibroblasts were exposed to soluble factors produced by Caco-2 cells, significant reductions in the expression of collagen types I, IV and V (Figure 2), and the SLRPs analyzed (decorin, biglycan, lumican and fibromodulin; Figure 2) were observed. When fibroblasts were exposed to soluble factors produced by HCT 116 cells, significant reductions in the expression levels of collagen types I and IV (Figure 2A and C), and all four SLRPs (decorin, biglycan, lumican and fibromodulin) (Figure 2E-H) were observed. No significant increases in the expression levels of ECM components were observed, only decreases, when fibroblasts were exposed solely to the soluble factors produced by the colorectal cancer cells. Therefore, we may hypothesize that cell-cell contact or proximity between the colorectal cancer cell-cells and fibroblasts is necessary to evoke an increase in the expression of fibrotic components.
As observed for the control bilayer co-cultures (Caco-2 cells seeded on Caco-2 cells, HCT 116 cells seeded on HCT 116 cells, and fibroblasts seeded on fibroblasts), Caco-2 and HCT 116 cells expressed low levels of fibromodulin in the bi-compartmental co-culture system (Figure 2H). Caco-2 also expressed low levels of collagen IV and biglycan (Figure 2 C and F). Therefore, both colorectal tumor cell lines expressed no or insignificant levels of the other ECM components analyzed, hence, the expression levels observed accounted primarily for expression by the fibroblasts (Figure 2). Since RNA
was only extracted from the cell type in the bottom compartment of the bi-compartmental co-culture system, the decreases in expression levels observed account for expression in the cell line in this compartment.
Expression and localization of ECM components in heterotypic co-cultures of colorectal cancer cells and fibroblasts using the O-ring system
The O-ring co-culture system mimics the tumor microenvironment in vivo, composed of the tumor and surrounding stroma which consists of both ECM and stromal cells such as fibroblasts. Stromal cells are seeded around the cancer cells and cell-cell contact is observed at the fibroblast/cancer cell interface. Besides cell-cell contact, a gradient of soluble factors produced by the cancer cells is established, where fibroblasts in closer proximity to the cancer cells will be exposed to higher concentrations of these factors and fibroblasts located distantly will be exposed to lower concentrations. Cells cultured using the O-ring co-culture system were analyzed by immunocytochemistry. The results obtained corroborated the findings from the bilayer and transwell co-culture systems. An accumulation of ECM components was observed in the zone where colorectal cancer cells and fibroblasts came into direct cell-cell contact (Figure 3). An increase in collagen I and collagen V immunolabeling was observed solely in fibroblasts located in the region of contact with the colorectal cancer cells (Figure 3A-C). The excess collagen deposited appeared to be unorganized and in bundles (Figure 3A). An increase in collagen IV immunolabeling was also observed in the region of fibroblast/colorectal cancer cell interface (Figure 3G). Fibromodulin immunolabeling increased only in fibroblasts located at the fibroblast/colorectal cancer cell interface (Figure 3D-E). An increase in biglycan immunolabeling was observed in
150 fibroblasts located in the region of contact with the colorectal cancer cells but not in fibroblasts located at a distance from the colorectal tumor cells and solely exposed to the soluble factors produced by the colorectal cancer cells (Figure 3F).
Interestingly, a sharp fibroblast/cancer cell interface was established when the fibroblasts were co-cultivated with colorectal tumor cells (Figure 3H). Therefore, the increases in ECM components and accumulation of fibrotic deposits in the area of intersection between the fibroblasts and the colorectal cancer cells possibly inhibited the migration of the tumor cells through the fibroblast area of this system. In contrast, we have previously shown that metastatic prostate tumor cells induce a decrease in the ECM produced by fibroblasts, and the prostate cancer cells migrate through the fibroblast area when co-cultivated using the O-ring system [25].
The fibroblasts were characterized as myofibroblasts after immunolocalization of organized sm -actin in the fibroblasts in all experimental models (results not shown).
Invasion of colorectal tumor cells through a 3-D stroma
In order to verify whether the desmoplasia surrounding colorectal tumors has a limiting effect on colorectal tumor cell invasion we used a 3-D stromagenic system (Amatangelo et al., 2005). 3-D stroma cultures with a cellular component of solely fibroblasts were compared to stroma cultures composed of both fibroblasts and colorectal cancer cells, the latter presenting characteristics of desmoplasia (Figure 4). The 3-D stroma composed of solely fibroblasts presented an organized 3-D fibronectin and collagen I matrix, whereas when colorectal cancer cells were co-cultivated with fibroblasts, fibronectin and collagen I matrix appeared as clumps with thickened and unorganized fibronectin fibers (Figure 4B). Moreover, an increase and loss of
organization of versican and perlecan were observed when colorectal cancer cells were co-cultivated with fibroblasts using the 3D culture system. GFP-expressing colorectal tumor cells were seeded onto this 3-D stroma and left to invade for 2 hours and the system observed using a confocal microscope (Figures 5 and 6). Interestingly, the colorectal tumor cells plated onto the desmoplastic stroma were not able to penetrate the stroma, whereas, the colorectal tumor cells seeded onto the control stroma were able to penetrate the stroma. Moreover, the colorectal tumor cells seeded onto the desmoplastic stroma presented large flattened cytoplasms, typical of adhered cells, whereas those seeded onto the control stroma presented small irregular cell shapes typical of migrating cells. The system was subsequently submitted to immunocytochemistry and vimentin staining was present in GFP-positive cells in both 3-D systems (results not shown). However, organized strong -actin filaments were solely detected in GFP-positive colorectal cancer cells invading through the fibroblast 3-D matrix (results not shown).
In vivo localization of ECM components in human colorectal tumors compared to non-neoplastic tissues
Co-cultures of colorectal tumor cells with fibroblasts clearly led to a desmoplastic reaction characterized by an increase in the expression and deposition of ECM components. In vitro, an increase in the expression and deposition of collagens I, III, IV and V, as well as, biglycan and fibromodulin were observed. In order to elicit whether these events mimic those which take place in vivo the expression and localization of ECM components were analyzed by examining the immunolocalization of collagens I, IV and V, decorin and fibromodulin in colorectal carcinoma compared to normal tissues. DAB staining revealed an impressive increase in ECM accumulation
152 surrounding colorectal adenocarcinomas when compared to non-neoplastic tissues. Collagens I and IV (Figure 7), collagen V (Figure 8), biglycan and fibromodulin (Figure 9) immunolabeling increased solely in the stroma surrounding epithelial cells in tumor samples (B, D, F, H) compared to non-neoplastic samples (A, C, E, G). Strong positive immunolabeling was observed for collagens IV and V in tumor samples when compared to normal tissues. An increase in collagen IV, biglycan and fibromodulin immunolabeling was also detected in the basal membrane of neoplastic glands compared to non-neoplastic tissues. Therefore, an increase in the expression of the same ECM components immediately surrounding the colorectal cancer cells was also observed in vivo characterizing a desmoplastic reaction and reflecting the in vitro results thereby validating the relevance of our in vitro system.
Responsiveness of ECM genes to direct cell-cell contact and soluble factors
Increases in the expression levels of all of the collagen types analyzed were observed as a result of direct cell-cell contact when fibroblasts were co-cultured with colorectal cancer cells (Table 2). The expression levels of collagen types III and IV in fibroblasts were not significantly affected by soluble factors produced by colorectal cancer cells (Table 2). Decorin and lumican expression levels possibly decreased in the fibroblasts after direct cell-cell contact with colorectal cancer cells, however, a significant decrease in expression levels was observed when fibroblasts were exposed to soluble factors produced by colorectal cancer cells (Table 2). Based on the differences in gene expression observed between the two cell co-culture systems, bilayer and bi-compartmental (Figures 1 and 2), used in this study, we may organize the genes
analyzed into two groups, those responsive to direct cell-cell contact and those responsive to soluble factors (Table 2).
154 Discussion
ECM accumulation surrounding tumors directly affects the growth and invasion of cancer cells. This process is thought to be a host defense reaction (desmoplastic reaction) aiming to confine the developing tumor [26]. However, desmoplasia has been associated with tumor progression and poor prognosis of colorectal carcinoma, squamous cell carcinoma, breast cancer and scirrhous gastric cancer [27-30]. On the other hand, desmoplastic reaction has been suggested to lead to tumor regression [31]. Different tumors present varying grades of fibrosis and the bulk of this fibrotic tissue is composed of collagen fibers and fibroblasts. In view of the controversial involvement of desmoplasia in tumor progression, understanding the effect this ECM accumulation has on cancer cell migration and invasiveness is of vital importance.
The presence of SLRPs in fibrous tissue surrounding cancer cells and their ability to suppress proliferation has been well characterized [9, 10, 32, 33]. SLRP binding to collagen has been shown to increase collagen fibril stability [34, 35] as well as, protect collagen fibrils from proteolytic cleavage by various collagenases [36]. SLRPs are thought to regulate the assembly of collagen matrix in connective tissues via their bi-functional character where the protein moiety binds collagen fibrils at strategic loci and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacing [37-40]. In co-cultures of colorectal cancer cells and fibroblasts, we observed increases in the expression of the ECM components collagen types I, III, IV and V, biglycan and fibromodulin, and possible decreases in decorin and lumican, as a result of direct cell-cell interactions. This would alter SLRP regulated collagen matrix assembly leading to disorganization of the ECM. The loss of collagen organization and control of fiber
thickness is evident in the 3D culture model, where the collagen and fibronectin fibers appear thickened and unorganized when fibroblasts where cultivated in the presence of colorectal tumor cells. SLRP and collagen up-regulation by fibroblasts could reflect a “host” response to the tumor cells, known as desmoplastic reaction. This up-regulation of ECM components was clear in both the bilayer culture system, the O-ring co-culture system and the 3D co-co-culture system, when cultivating fibroblasts and the colorectal cancer cell lines Caco-2 and HCT 116. Furthermore, our in vitro desmoplastic reaction was validated through immunohistochemistry of human colorectal carcinoma and non-neoplastic tissues. An impressive increase in collagens IV and V was observed in the desmoplastic reaction of colorectal adenocarcinoma. Collagen I, biglycan and fibromodulin were also confirmed as constituents of the fibrotic tissue surrounding colorectal tumors.
Wang and colleagues (2006) analyzed differential gene expression in co-cultures of prostate cancer cells and bone marrow stromal cells comparing the insert system and contact system, and identified three sets of genes: those that were modified only by soluble factors, those by both soluble factors and physical contact, and those only by physical contact [41]. These authors observed a unique set of genes that were regulated only by physical contact, including the genes encoding collagens III and IV, MMP-9, biglycan, and TGF1. We also observed regulation of expression levels of collagen types I, III, IV and V, biglycan and fibromodulin, as a result of direct cell-cell interactions between fibroblasts and colorectal tumor cells. However, the expression levels of collagen types I and V, biglycan and fibromodulin were also influenced by soluble factors. Interestingly,these ECM components increased in fibroblasts in response to cell-cell contact with colorectal cancer cells and decreased in fibroblasts in
156 response to soluble factors produced by colorectal cancer cells, but in the O-ring co-culture system where both cell-cell contact and soluble factors were at play, we observed an increase in these ECM components solely at the fibroblast-colorectal cancer cell interface.
Invasion of the fibrotic tissue surrounding tumors is necessary for cancer cell migration and eventual metastasis. Therefore, establishing whether the desmoplastic reaction surrounding many tumors restricts or supports the invasion of tumor cells is of vital importance; moreover, desmoplasia has been suggested as a prognostic marker and for staging of various cancers. Our data shows that colorectal tumor cells invade control stroma (produced by and consisting of normal fibroblasts) at a faster rate than desmoplastic stroma; therefore, supporting the idea that desmoplasia restricts colorectal tumor progression. Desmoplastic reaction in colorectal carcinoma has been associated with favorable prognosis [42, 43]. Moreover, basement membrane deposition has also been associated with favorable prognosis and tumor cell differentiation in colon cancer [44-46]. Cell migration is controlled by the ECM either through matrix bound adhesive molecules or by cells migrating along organized matrix fibers (contact guidance) [47]. Therefore, the unorganized matrix observed in the desmoplastic stroma, due to the up-regulation of ECM components and altered collagen matrix assembly, could have played a role in limiting the migration of the colorectal tumor cells in the invasion assay.
This study demonstrates that colorectal cancer cells Caco-2 and HCT-116 induce a desmoplastic reaction when co-cultivated in direct cell-cell contact with myofibroblasts. Fibronectin, collagens I and V were detected in this desmoplastic reaction as
up-regulated and unorganized, distributed as bundles of thickened fibers with no apparent orientation. Our in vitro desmoplasia model was characterized by the expression of collagens I, III, IV and V, as well as, fibromodulin and biglycan. These components were detected in in vivo desmoplasia presenting colorectal tissues, thereby validating our in vitro model. Interestingly, the presence of the desmoplastic reaction in in vitro stroma inhibited both the migration and invasion of colorectal tumor cells. Therefore, our data supports the idea that desmoplasia restricts colorectal tumor progression.
158 Acknowledgements
This work was supported byFundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP (2007/59801-1), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). We would like to thank Prof. Peter Reinach for his kind support throughout this study. We also acknowledge Caroline Z. Romera and Elizabeth N. Kanashiro (INFAR/UNIFESP, Brazil) for their technical assistance.
References
[1] Kunz‐Schughart LA, and Knuechel R (2002). Tumor‐associated fibroblasts (part I): Active stromal participants in tumor development and progression? Histol Histopathol 17, 599‐621.
[2] Gress TM, Muller‐Pillasch F, Lerch MM, Friess H, Buchler M, and Adler G (1995). Expression and in‐situ localization of genes coding for extracellular matrix proteins and extracellular matrix degrading proteases in pancreatic cancer. Int J Cancer 62, 407‐413. [3] Faouzi S, Le Bail B, Neaud V, Boussarie L, Saric J, Bioulac‐Sage P, Balabaud C, and Rosenbaum J (1999). Myofibroblasts are responsible for collagen synthesis in the stroma of human hepatocellular carcinoma: an in vivo and in vitro study. J Hepatol 30, 275‐284.
[4] Shi Y, Niculescu R, Wang D, Ormont M, Magno M, San Antonio JD, Williams KJ, and Zalewski A (2000). Myofibroblast involvement in glycosaminoglycan synthesis and lipid retention during coronary repair. J Vasc Res 37, 399‐407.
[5] Gressner AM (1994). Activation of proteoglycan synthesis in injured liver‐‐a brief review of molecular and cellular aspects. Eur J Clin Chem Clin Biochem 32, 225‐237. [6] Apte MV, Park S, Phillips PA, Santucci N, Goldstein D, Kumar RK, Ramm GA, Buchler M,
Friess H, McCarroll JA, et al. (2004). Desmoplastic reaction in pancreatic cancer: role of pancreatic stellate cells. Pancreas 29, 179‐187.
[7] Hanamura N, Yoshida T, Matsumoto E, Kawarada Y, and Sakakura T (1997). Expression of fibronectin and tenascin‐C mRNA by myofibroblasts, vascular cells and epithelial cells in human colon adenomas and carcinomas. Int J Cancer 73, 10‐15.
[8] Hauptmann S, Zardi L, Siri A, Carnemolla B, Borsi L, Castellucci M, Klosterhalfen B, Hartung P, Weis J, Stocker G, et al. (1995). Extracellular matrix proteins in colorectal carcinomas. Expression of tenascin and fibronectin isoforms. Lab Invest 73, 172‐182. [9] Leygue E, Snell L, Dotzlaw H, Hole K, Hiller‐Hitchcock T, Roughley PJ, Watson PH, and Murphy LC (1998). Expression of lumican in human breast carcinoma. Cancer Res 58, 1348‐1352. [10] Leygue E, Snell L, Dotzlaw H, Troup S, Hiller‐Hitchcock T, Murphy LC, Roughley PJ, and Watson PH (2000). Lumican and decorin are differentially expressed in human breast carcinoma. J Pathol 192, 313‐320. [11] Ishiwata T, Cho K, Kawahara K, Yamamoto T, Fujiwara Y, Uchida E, Tajiri T, and Naito Z (2007). Role of lumican in cancer cells and adjacent stromal tissues in human pancreatic cancer. Oncol Rep 18, 537‐543.
[12] Augoff K, Rabczynski J, Tabola R, Czapla L, Ratajczak K, and Grabowski K (2008). Immunohistochemical study of decorin expression in polyps and carcinomas of the colon. Med Sci Monit 14, CR530‐535.
[13] Seya T, Tanaka N, Shinji S, Yokoi K, Koizumi M, Teranishi N, Yamashita K, Tajiri T, Ishiwata T, and Naito Z (2006). Lumican expression in advanced colorectal cancer with nodal metastasis correlates with poor prognosis. Oncol Rep 16, 1225‐1230. [14] Viola M, Bartolini B, Sonaggere M, Giudici C, Tenni R, and Tira ME (2007). Fibromodulin interactions with type I and II collagens. Connect Tissue Res 48, 141‐148. [15] Svensson L, Heinegard D, and Oldberg A (1995). Decorin‐binding sites for collagen type I are mainly located in leucine‐rich repeats 4‐5. J Biol Chem 270, 20712‐20716.
[16] Sampaio Lde O, Bayliss MT, Hardingham TE, and Muir H (1988). Dermatan sulphate proteoglycan from human articular cartilage. Variation in its content with age and its
160 structural comparison with a small chondroitin sulphate proteoglycan from pig laryngeal cartilage. Biochem J 254, 757‐764.
[17] Danielson KG, Baribault H, Holmes DF, Graham H, Kadler KE, and Iozzo RV (1997). Targeted disruption of decorin leads to abnormal collagen fibril morphology and skin fragility. J Cell Biol 136, 729‐743.
[18] Santra M, Skorski T, Calabretta B, Lattime EC, and Iozzo RV (1995). De novo decorin gene expression suppresses the malignant phenotype in human colon cancer cells.
Proc Natl Acad Sci U S A 92, 7016‐7020.
[19] Weber CK, Sommer G, Michl P, Fensterer H, Weimer M, Gansauge F, Leder G, Adler G, and Gress TM (2001). Biglycan is overexpressed in pancreatic cancer and induces G1‐ arrest in pancreatic cancer cell lines. Gastroenterology 121, 657‐667.
[20] Ronnov‐Jessen L, and Petersen OW (1993). Induction of alpha‐smooth muscle actin by transforming growth factor‐beta 1 in quiescent human breast gland fibroblasts. Implications for myofibroblast generation in breast neoplasia. Lab Invest 68, 696‐707. [21] Ronnov‐Jessen L, Petersen OW, Koteliansky VE, and Bissell MJ (1995). The origin of the
myofibroblasts in breast cancer. Recapitulation of tumor environment in culture unravels diversity and implicates converted fibroblasts and recruited smooth muscle cells. J Clin Invest 95, 859‐873.
[22] Qian SW, Burmester JK, Tsang ML, Weatherbee JA, Hinck AP, Ohlsen DJ, Sporn MB, and Roberts AB (1996). Binding affinity of transforming growth factor‐beta for its type II receptor is determined by the C‐terminal region of the molecule. J Biol Chem 271, 30656‐30662.
[23] Iozzo RV (1985). Neoplastic modulation of extracellular matrix. Colon carcinoma cells release polypeptides that alter proteoglycan metabolism in colon fibroblasts. J Biol
Chem 260, 7464‐7473.
[24] Livak KJ, and Schmittgen TD (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods 25, 402‐408. [25] Coulson‐Thomas VJ, Gesteira TF, Coulson‐Thomas YM, Vicente CM, Tersariol IL, Nader
HB, and Toma L (2010). Fibroblast and prostate tumor cell cross‐talk: Fibroblast differentiation, TGF‐beta, and extracellular matrix down‐regulation. Exp Cell Res. [26] Angeli F, Koumakis G, Chen MC, Kumar S, and Delinassios JG (2009). Role of stromal
fibroblasts in cancer: promoting or impeding? Tumour Biol 30, 109‐120.
[27] Halvorsen TB, and Seim E (1989). Association between invasiveness, inflammatory reaction, desmoplasia and survival in colorectal cancer. J Clin Pathol 42, 162‐166. [28] Breuninger H, Schaumburg‐Lever G, Holzschuh J, and Horny HP (1997). Desmoplastic
squamous cell carcinoma of skin and vermilion surface: a highly malignant subtype of skin cancer. Cancer 79, 915‐919.
[29] Hasebe T, Mukai K, Tsuda H, and Ochiai A (2000). New prognostic histological parameter of invasive ductal carcinoma of the breast: clinicopathological significance of fibrotic focus. Pathol Int 50, 263‐272.
[30] Yashiro M, Chung YS, Nishimura S, Inoue T, and Sowa M (1996). Fibrosis in the peritoneum induced by scirrhous gastric cancer cells may act as "soil" for peritoneal dissemination. Cancer 77, 1668‐1675.
[31] Martin MS, Caignard A, Hammann A, Pelletier H, and Martin F (1987). An immunohistological study of cells infiltrating progressive and regressive tumors induced by two variant subpopulations of a rat colon cancer cell line. Int J Cancer 40, 87‐93.
[32] Adany R, and Iozzo RV (1990). Altered methylation of versican proteoglycan gene in human colon carcinoma. Biochem Biophys Res Commun 171, 1402‐1413.
[33] Reed CC, Gauldie J, and Iozzo RV (2002). Suppression of tumorigenicity by adenovirus‐ mediated gene transfer of decorin. Oncogene 21, 3688‐3695.
[34] Keene DR, San Antonio JD, Mayne R, McQuillan DJ, Sarris G, Santoro SA, and Iozzo RV (2000). Decorin binds near the C terminus of type I collagen. J Biol Chem 275, 21801‐ 21804.
[35] Neame PJ, Kay CJ, McQuillan DJ, Beales MP, and Hassell JR (2000). Independent modulation of collagen fibrillogenesis by decorin and lumican. Cell Mol Life Sci 57, 859‐ 863.
[36] Geng Y, McQuillan D, and Roughley PJ (2006). SLRP interaction can protect collagen fibrils from cleavage by collagenases. Matrix Biol 25, 484‐491.
[37] Linsenmayer TF, Fitch JM, and Birk DE (1990). Heterotypic collagen fibrils and stabilizing collagens. Controlling elements in corneal morphogenesis? Ann N Y Acad Sci 580, 143‐160.
[38] Weber IT, Harrison RW, and Iozzo RV (1996). Model structure of decorin and implications for collagen fibrillogenesis. J Biol Chem 271, 31767‐31770.
[39] Scott JE (1996). Proteodermatan and proteokeratan sulfate (decorin, lumican/fibromodulin) proteins are horseshoe shaped. Implications for their interactions with collagen. Biochemistry 35, 8795‐8799.
[40] Orgel JP, Eid A, Antipova O, Bella J, and Scott JE (2009). Decorin core protein (decoron) shape complements collagen fibril surface structure and mediates its binding. PLoS
One 4, e7028.
[41] Wang J, Levenson AS, and Satcher RL, Jr. (2006). Identification of a unique set of genes altered during cell‐cell contact in an in vitro model of prostate cancer bone metastasis.
Int J Mol Med 17, 849‐856.
[42] Ueno H, Jones AM, Wilkinson KH, Jass JR, and Talbot IC (2004). Histological categorisation of fibrotic cancer stroma in advanced rectal cancer. Gut 53, 581‐586. [43] Caporale A, Amore Bonapasta S, Scarpini M, Ciardi A, Vestri A, Ruperto M, and Giuliani
A (2010). Quantitative investigation of desmoplasia as a prognostic indicator in colorectal cancer. J Invest Surg 23, 105‐109.
[44] Forster SJ, Talbot IC, and Critchley DR (1984). Laminin and fibronectin in rectal adenocarcinoma: relationship to tumour grade, stage and metastasis. Br J Cancer 50, 51‐61.
[45] Havenith MG, Arends JW, Simon R, Volovics A, Wiggers T, and Bosman FT (1988). Type IV collagen immunoreactivity in colorectal cancer. Prognostic value of basement membrane deposition. Cancer 62, 2207‐2211. [46] Bosman FT, de Bruine A, Flohil C, van der Wurff A, ten Kate J, and Dinjens WW (1993). Epithelial‐stromal interactions in colon cancer. Int J Dev Biol 37, 203‐211. [47] Painter KJ (2009). Modelling cell migration strategies in the extracellular matrix. J Math Biol 58, 511‐543.
162 Figure legends
Figure 1. Gene expression of collagens and SLRPs after heterotypic bilayer co-culture of colorectal cancer cells and fibroblasts. The colorectal cancer cell lines Caco-2 and HCT 116 were seeded on top of previously seeded fibroblasts (CACO2/WPF5 and HCT116/WPF5, respectively) and fibroblasts were seeded on top of the previously seeded colorectal cancer cell lines (WPF5/CACO2 and WPF5/HCT116, respectively). After 24 hours, RNA was extracted for analysis by real time PCR of collagen I (A), collagen III (B), collagen IV (C), collagen V (D) decorin (E), biglycan (F), lumican (G) and fibromodulin (H). Controls were performed seeding the same cell type on top and underneath (WPF5/WPF5, CACO2/CACO2 and HCT116/HCT116). Gene expression was normalized against ribosomal protein S29 (RPS29).
Figure 2. Gene expression of collagens and SLRPs after bi-compartmental (transwell) co-culture of colorectal cancer cells and fibroblasts. Fibroblasts (WPF5) and prostate cancer cells (CACO2 and HCT116) were grown both in transwell inserts (0.4 μm membrane pores) and in microplate wells to study the effect of soluble factors in the cross-talk between the cell lines. RNA extracted from the cells in the bottom compartment was analyzed through quantitative RT–PCR. The experimental groups comprised seeding the colorectal tumor cell lines in the top compartment and the fibroblasts in the bottom compartment (tCACO2/WPF5 and tHCT116/WPF5) as well as the fibroblasts in the top compartment and the cancer cell lines in the bottom compartment (tWPF5/CACO2 and tWPF5/HCT116). The control groups entailed seeding the same cells in both the top and bottomcompartments (tWPF5/WPF5;
tCACO2/CACO2; tHCT116/HCT116). The expression of collagen I (A), collagen III (B), collagen IV (C), collagen V (D), decorin (E), biglycan (F), lumican (G) and fibromodulin (H) was analyzed through real time PCR. Gene expression was normalized against ribosomal protein S29 (RPS29). *p < 0.05.
Figure 3. Expression and localization of collagen types I, IV and V, fibromodulin and biglycan after co-culture of colorectal cancer cells and fibroblasts using the O-ring system. Experimental groups entailed seeding the colorectal cancer cell lines Caco-2 and HCT 116 inside the O-ring and fibroblasts around the O-ring (WPF5 & CACO2 and WPF5 & HCT116, respectively). Control groups consisted of seeding the same cell type inside and around the O-ring (WPF5, CACO2, HCT116). (A) Collagen I (red) and collagen V (green) were immunolocalized in cells cultured using the O-ring system. (B) Collagen I (red) and fibromodulin (green) were immunolocalized in cells cultured using the O-ring system.Fluorescent labeling of collagen I (C) collagen V (D) and fibromodulin (E) was quantified using the LSM image browser (*p<0.05). Biglycan (F) and collagen IV (G) were immunolocalized in cells cultured using the O-ring system where the colorectal cancer cell line Caco-2 (Ca) was seeded inside the O-ring and fibroblasts (Fi) around the O-ring. (H) Phase contrast image of the O-ring system where the colorectal cancer cell line Caco-2 was seeded inside the O-ring and fibroblasts around the O-ring. Asterisks indicate the region of fibroblast/colorectal cancer cell interface. Nuclei are DAPI stained (blue). Scale bar: 20 m (A and B) and 100 m (F and G). (*p<0.05).
164 Figure 4. 3-D stromagenic model. 3-D co-cultures were performed in which fibroblasts (WPF5) or colorectal cancer cells (Caco-2) were seeded on top of previously plated confluent fibroblasts (WPF5 and WPF5 + CACO2, respectively). The cultures were treated with ascorbic acid every other day to produce a 3-D stromagenic system with a cellular component of solely fibroblasts or a 3-D stromagenic system composed of both fibroblasts and colorectal cancer cells (with desmoplastic reaction). (A) Phase contrast images; (B) Fluorescent labeling of fibronectin, collagen I, perlecan and versican. Nucleus stained with DAPI (blue). Scale bar: 20m.
Figure 5. Invasion assay of colorectal cancer cells (Caco-2) through a 3-D fibroblast-produced matrix.Caco-2 cells expressing GFP (green) were seeded onto 3-D control stroma (WPF5) or 3-D desmoplastic stroma (WPF5 + CACO2) and confocal images obtained 2 hours later. A series of z-axis optical sections were collected, acquired at 1m intervals using the 40X objective. Maximum projection reconstructed confocal images of Caco-2 cells (green) migrating into a 3-D control stroma (WPF5) or a 3-D desmoplastic stroma (WPF5 + CACO2) were acquired using the x axis (A) and z axis (B). Arrows indicate direction of migration.
Figure 6. Invasion assay of colorectal cancer cells (HCT 116) through a 3-D fibroblast-produced matrix. HCT 116 cells expressing GFP (green) were seeded onto 3-D control stroma (WPF5) or 3-3-D desmoplastic stroma (WPF5 + HCT 116) and confocal images obtained 2 hours later. A series of z-axis optical sections were collected, acquired at 1m intervals using the 40X objective. Maximum projection reconstructed confocal images of HCT 116 cells (green) migrating into a 3-D control stroma (WPF5)
or a 3-D desmoplastic stroma (WPF5 + HCT 116) were acquired using the x axis (A) and z axis (B). Arrows indicate direction of migration.
Figure7. Localization of collagen types I and IV in colorectal carcinoma and non-neoplastic tissues. Immunoreactivity of collagen I (A and B) and collagen IV (C and D) in colorectal tissues shows an increase in collagen deposition surrounding adenocarcinoma (B and D) when compared to normal tissues (A and C). Increased expression of collagens I and IV were observed in basal membrane of neoplastic glands when compared to non-neoplastic tissue. Increased collagen IV immunoreactivity is also observed in the carcinoma cell cytoplasm when compared to non-neoplastic tissues. Images were obtained using a 40X objective. Scale bar: 20m.
Figure 8. Localization of collagen type V in colorectal carcinoma and non-neoplastic tissue. Collagen V was immunolocalized in colorectal tissues using DAB and counter stained with hematoxylin. Collagen V increases in the extracellular matrix of colorectal carcinoma (B,D,F) when compared to non-neoplastic tissues (A, C, E). A and B were obtained with a 20X objective, C, D, E and F were obtained using a 40X objective. Sample shown in E was revealed omittingthe primary antibody. Scale bar: 20m
Figure 9. Localization of biglycan and fibromodulin in colorectal carcinoma and non-neoplastic tissue. Biglycan and fibromodulin were immunolabeled in colorectal tissues using DAB and counter stained with hematoxylin. Biglycan (A,B) and fibromodulin (C,D,E,F) increase in the basal membrane of neoplastic glands (B,D,F) when compared to normal tissues (A,C,E). Increased fibromodulin immunoreactivity is also observed in
166 the carcinoma cell cytoplasm when compared to non-neoplastic tissues.C and D images were obtained using a 20X objective and A, B, E and F images with a 40X objective. Scale bar: 20m.
Supplemental Figure 1. Invasion assay of colorectal cancer cells (CACO2) through a 3-D fibroblast-produced matrix. Caco-2 cells expressing GFP (green) were seeded onto 3-D control stroma (WPF5) or 3-D desmoplastic stroma (WPF5 + CACO2) and confocal images obtained 2 hours later. A series of z-axis optical sections were collected, acquired at 1m intervals using the 40X objective of migrating into a 3-D control stroma (WPF5) or a 3-D desmoplastic stroma (WPF5 + CACO2).
Supplemental Figure 2. Invasion assay of colorectal cancer cells (HCT 116) through a 3-D fibroblast-produced matrix. HCT 116 cells expressing GFP (green) were seeded onto 3-D control stroma (WPF5) or 3-D desmoplastic stroma (WPF5 + HCT 116) and confocal images obtained 2 hours later. A series of z-axis optical sections were collected, acquired at 1m intervals using the 40X objective of migrating into a 3-D control stroma (WPF5) or a 3-D desmoplastic stroma (WPF5 + HCT 116).
Table 1. Clinical details of patients with colorectal cancer
Age Gender Location Size Differentiation
65 M Rectum 9 cm Moderate
56 M Rectum 4 cm Moderate
51 M Rectum 2 cm Well
57 M Rectum 6 cm Moderate
168 Table 2.Gene responsiveness to direct cell-cell contact, soluble factors and both cell-cell contact and soluble factors
Direct cell-cell contact Soluble factors Direct cell-cell contact and
soluble factors Collagen III Collagen IV Lumican Decorin Collagen I Collagen V Biglycan Fibromodulin
Figurre 2.
