• Nenhum resultado encontrado

Viabilidade celular e expressão do gene ftsZ em biofilmes de "Enterococcus faecalis" expostos ao pH alcalino = Cell viability and ftsZ gene expression of "Enterococcus faecalis" biofilms exposed to alkaline pH

N/A
N/A
Protected

Academic year: 2021

Share "Viabilidade celular e expressão do gene ftsZ em biofilmes de "Enterococcus faecalis" expostos ao pH alcalino = Cell viability and ftsZ gene expression of "Enterococcus faecalis" biofilms exposed to alkaline pH"

Copied!
69
0
0

Texto

(1)

UNIVERSIDADE ESTADUAL DE CAMPINAS Faculdade de Odontologia de Piracicaba

TIAGO PEREIRA DA ROSA

VIABILIDADE CELULAR E EXPRESSÃO DO GENE ftsZ EM

BIOFILMES DE ENTEROCOCCUS FAECALIS EXPOSTOS

AO PH ALCALINO

CELL VIABILITY AND ftsZ GENE EXPRESSION OF

ENTEROCOCCUS FAECALIS BIOFILMS EXPOSED TO

ALKALINE PH

PIRACICABA 2017

(2)

VIABILIDADE CELULAR E EXPRESSÃO DO GENE ftsZ EM

BIOFILMES DE ENTEROCOCCUS FAECALIS EXPOSTOS

AO PH ALCALINO

CELL VIABILITY AND ftsZ GENE EXPRESSION OF

ENTEROCOCCUS FAECALIS BIOFILMS EXPOSED TO

ALKALINE PH

Tese apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas como parte dos requisitos exigidos para obtenção do título de Doutor em Clínica Odontológica, na área de Endodontia.

Thesis presented to the Piracicaba Dental School of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor in Clinical Dentistry, in Endodontic Area.

Orientador: Prof. Dr. Rogério de Castilho Jacinto

Coorientadora: Profa. Dra. Brenda Paula Figueiredo de Almeida Gomes

Este exemplar corresponde à versão final da tese defendida pelo aluno Tiago Pereira da Rosa e orientada pelo Prof. Dr. Rogério de Castilho Jacinto

PIRACICABA 2017

(3)

Ficha catalográfica

Universidade Estadual de Campinas

Biblioteca da Faculdade de Odontologia de Piracicaba Marilene Girello - CRB 8/6159

Rosa, Tiago Pereira da, 1984-

R71v RosViabilidade celular e expressão do geneftsZem biofilmes deEnterococcus faecalis expostos ao pH alcalino / Tiago Pereira da Rosa. – Piracicaba, SP :

[s.n.], 2017.

RosOrientador: Rogério de Castilho Jacinto.

Coorientador: Brenda Paula Figueiredo de Almeida Gomes.

RosTese (doutorado) – Universidade Estadual de Campinas, Faculdade de Odontologia de Piracicaba.

Ros1. Biofilme. 2.Enterococcus faecalis. 3. Alcalinização. 4. Sobrevivência celular. 5. Expressão gênica. I. Jacinto, Rogério de Castilho. II. Universidade Estadual de Campinas. Faculdade de Odontologia de Piracicaba. III. Título.

Informações para Biblioteca Digital

Título em outro idioma: Cell viability and ftsZ gene expression of Enterococcus faecalis biofilms exposed to alkaline pH

Palavras-chave em inglês: Biofilms Enterococcus faecalis Alkalinization Cell survival Gene expression

Área de concentração:Endodontia

Titulação: Doutor em Clínica Odontológica Banca examinadora:

Rogério de Castilho Jacinto [Orientador] Emmanuel João Nogueira Leal da Silva Fernanda Graziela Corrêa Signoretti Alexandre Augusto Zaia

Daniel Rodrigo Herrera Morante Data de defesa: 10-02-2017

Programa de Pós-Graduação:Clínica Odontológica

(4)
(5)

Dedicatória

Aos meus pais Pedro Bittencourt da Rosa e Arlete Pereira da Rosa,

Incontáveis foram as vezes que meu cansaço e preocupação foram compartilhados por vocês, procurando amenizar minha ansiedade, mantendo-me firme diante dos obstáculos, em uma união que sempre me incentiva a prosseguir. Fui criado em um lar com muito amor, por isso, ao ver a louca realidade em que vivemos hoje compreendo cada vez mais o significado do seu carinho e dedicação em minha formação. Obrigado por sua dedicação, apoio e por me ensinar valores como honestidade, perseverança, responsabilidade, humildade, respeito e tolerância. Sou e serei eternamente grato por tudo que vocês fizeram e ainda fazem por mim. Eu tenho muito orgulho de ser seu filho e muita admiração pelos pais que tenho. Obrigado por tudo. Amo muito vocês!

(6)

À Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas (FOP/UNICAMP),

Nas pessoas do diretor Prof. Dr. Guilherme Elias Pessanha Henriques e do diretor associado Prof. Dr. Francisco Haiter Neto. Da Profª. Drª. Cinthia Pereira Machado Tabchoury, coordenadora geral dos cursos de Pós-Graduação e da Profa. Dra. Karina Gonzales Silverio Ruiz, coordenadora do curso de Pós-Graduação em Clínica Odontológica.

Ao amigo e orientador Prof. Dr. Rogério de Castilho Jacinto,

Serei sempre grato pela grande oportunidade de aprendizado, pelos ensinamentos transmitidos, pelos conselhos e ajudas nas tomadas de decisão. Obrigado por abrir portas que me possibilitaram ter um enorme ganho profissional e pessoal durante todo o Mestrado e Doutorado. Obrigado por sua amizade, dedicação, respeito e confiança.

À minha querida co-orientadora Profª. Drª. Brenda Paula Figueiredo de Almeida Gomes,

Pelo carinho, atenção, apoio, confiança, por seus ensinamentos e pelas oportunidades. Obrigado pelas conversas e conselhos, a senhora é para mim um grande exemplo de dinamismo e dedicação ao trabalho. Tenho grande carinho pela Sra. e ótimas lembraças.

Aos professores da disciplina de Endodontia da FOP/UNICAMP,

Profa. Drª. Adriana de Jesus Soares, Prof. Dr. Alexandre Augusto Zaia, Profª. Drª. Brenda Paula Figueiredo de Almeida Gomes, Prof. Dr. Caio Cezar Randi Ferraz, Prof. Dr. Francisco José de Souza-Filho (in memoriam) e Prof. Dr. José Flávio Affonso de Almeida, conhecer e conviver com cada um de vocês foi um privilégio. A nossa convivência me proporcionou momentos de muita alegria e amadurecimento pessoal e profissional. Obrigado pelo carinho!

(7)

Profa. Drª. Thais Mageste Duque e a suplente Profa. Drª. Adriana de Jesus Soares. Agradeço por aceitarem tão prontamente o convite para participar da banca e por suas colaborações para este trabalho.

Aos professores examinadores da banca de defesa,

Prof. Dr. Alexandre Augusto Zaia, Prof. Dr. Emmanuel João Nogueira Leal da Silva, Prof. Dr. Daniel Rodrigo Herrera Morante, Profa. Dra. Fernanda Graziela Corrêa Signoretti, Prof. Dr. Rogério de Castilho Jacinto e aos suplentes Profa. Drª. Adriana de Jesus Soares, Prof. Dr. Carlos Augusto Pantoja, Profa. Drª. Thais Mageste Duque. Agradeço por aceitarem tão prontamente o convite para participar da banca e por suas colaborações para este trabalho.

Aos colegas e amigos da FOP,

Alexandre Freire, Amanda Falcão, Ana Carolina Pimentel, Ana Mascarenhas, Andrea Cardoso Pereira, Andrea Araújo, Augusto Rodrigues Lima, Aniele Lacerda, Angelina Bergamin, Ariane Marinho, Bruno Bueno Silva, Camila Lima, Carlos Augusto Pantoja, Carolina Santos, Cláudia Suzuki, Cimara Barroso, Conrado Caetano, Eduardo Sousa Jr., Elilton Pinheiro Jr., Eloa Pereira, Érika Clavijo, Erika Condo, Erika Harth, Estela Winocur, Ezilmara Rolim de Sousa, Daniel Herrera, Daniela Miyagaki, Day Oliveira, Darklilson Santos, Diogo H. Silva, Diego Nóbrega, Emmanuel João da Silva, Fábio Fabretti, Fabrício Rutz, Felipe Anacleto, Fernanda Lins, Fernanda Signoretti, Fernando Rigolin, Flávia Saavedra, Francisco Montagner, Frederico Martinho, Frederico Manhães, Frederico Sampaio, Giselle Abi Rached, Giancarlo De la Torre, Jaqueline Lazzari, Jefferson Marion, Jonny Burga Sanchez, Juliana Nagata, Karine Schell, Kat Yusk, Karina Moraes, Laura Ramirez, Leonardo Peroni, Letícia Gonçalves, Letícia Nóbrega, Lívia Foster, Luale Leão, Lucas Alves Moura, Luiz Eduardo Ferreira, Maira do Prado, Manuela Rocha, Marcos Endo, Marcos Frozoni, Maria Raquel Monteiro, Mario Zuolo, Marisol Mayco, Marianne Carvalho, Marlos Ribeiro, Maximiana Maliska, Milton Cougo, Núbia Pini, Pedro Ricomini, Plínio Senna, Polliane Carvalho, Priscila Peyneau, Rafaela Chapola, Rafael Orro, Raquel Werczler, Regiane Amaral, Rodrigo Vasconcellos, Rosa L. Abuhadba Moscoso, Sibele Aquino, Tereza Pedroza, Thais Accorsi, Thais Mageste Duque, Thais Harder, Thiago Farias, Thiago Gamba, Tiago Vianna, Veber Bomfim, Victor Muñoz, Victor Toral, Wilfredo González, Yuri Nejaim, Zarina das Neves, entre outros, por compartilhar de sua alegria, companheirismo, amizade e experiências.

(8)

Luis, Maicon Passini, Eliane Narvaes, Paulo Alcarde, Eliane Melo, pelo carinho, amizade, por sua ajuda, conselhos e ensinamentos.

À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES),

Pelo suporte financeiro – Processo no. 5626-13-7 e no. 10342-12-5.

À School of Dentistry da Oregon Health & Science University (OHSU) – Portland OR,

Nas pessoas do diretor Prof. Dr. Phillip T. Marucha e diretor associado à pesquisa Prof. Dr. David Morton.

À minha co-orientadora no exterior Profa. Dra. Christine M. Sedgley,

Orientadora e ser humano admirável, mesmo diante de problemas pessoais enormes, se dispôs ao máximo para atender minhas dúvidas e contribuir para que meu período de estágio no exterior tivesse um bom aproveitamento.

À Profa. Dra. Kirsten J. Lampi e ao Prof. Dr. Michael V. Danilchik,

Exímios pesquisadores, exemplos de humildade e generosidade. “Mike” dedicou parte do seu tempo à me orientar no uso do Confocal. “Dr. L”, me “adotou” nos momentos de ausência da Dra. Sedgley, me fez sentir verdadeiramente parte da equipe. Agradeço por disponibilizar seu laboratório e equipamentos para a condução dos experimentos.

Aos companheiros de laboratório e corredores da OHSU,

Guy Simmons, Melissa Andrew, Jackson Wongshofsky, Hannah Powell, Selina Garces, McWilbes Mibya, Gedalias Martim e sua esposa Jaqueline Martim, Jason Kung, Ataís Bacchi, Adam Dobson, Profa. Dra. Carmem Pfeifer sem sua amizade e

(9)

Corey Bunch, Suzi Bunch, Jonathan Bunch, Stephen Lamar Caston, Erin Monahan, Joshua Logue, Kevin Strom, Zach Job, Adam Snyder, Ralph Daub, Robert Logue, Dan Gaston, Mistie Dymond, Jesse Sugar Moore, Cory Knoblauch, Byron Etta, Nora Jamerson, Tyler Nelson, Zach Markiss, Kate Markiss, Dan Zinder, Kris Torgles, Melissa Gorris, Matthew Richard, Nilesh Bahir, Jacob Hill, Jeremy LaGoo, Gina Burgess, Brian Lawrence, algumas das pessoas fantásticas que encontrei nessa cidade maravilhosa. Com vocês aprendi, dei boas risadas, escalei, viajei, tive as mais diversas experiências que me fizeram sentir em casa.

Aos queridos Lane Poncy e Doug Poncy (in memoriam),

Meus avós / pais / amigos em Portland, foi muito bom dividir esse ano maravilhoso com vocês. Aprendi muito com nossas conversas. Para Lane não tem tempo ruim, sempre com sorriso no rosto e uma risada contagiante. Voltar para casa e encontra-la assistindo seriado ou indignada por estar “apanhando” para suas amigas no scrabble não tem preço, saudades!

À Kickass Roadtrip,

Eric Koczab, Justin Weihs, Benny Gill, Michael Brewer. Proporcionaram uma das melhores viagens da minha vida, conhecendo lugares que turista algum imaginou visitar e realizando proezas que jamais pensei em fazer, tudo em ótima companhia.

Aos amigos e professores do curso de Especialização em Endodontia da ABO/SC, Prof. Dr. Braulio Pasternak Jr.; Prof. Dr. César Augusto Pereira Oliveira; Prof. Guy Martins Pereira por sua amizade, seus ensinamentos, incentivo, auxílio e parceria que permanece até hoje.

Prof. Drª. Mabel Mariela Rodríguez Cordeiro, minha eterna orientadora, por seu exemplo de dedicação ao desenvolvimento de pesquisas sérias e de qualidade, mesmo diante das adversidades.

Tenho profunda admiração e respeito pelo trabalho que desenvolvem em Florianópolis.

(10)

Prof. Dr. Ricardo Ferreira, Profa. Larissa Fernanda Pinto, Prof. Gustavo da Luz Vieira, Profa. Dra. Márcia Gonçalves Lucena, Prof. Oberdam Ferreira.

Ao 38º Batalhão de Infantaria do Exército Brasileiro, Vila Velha – ES,

Nas pessoas do Cel Hiroshi, comandante do batalhão; Cel Nailson, subcomandante; Maj Isabel Delgado, chefe do Posto Médico; Cap Pollyana Darós, chefe do gabinete odontológico; Cap Carolina, 1º Ten Silva Rodrigues, 1º Ten Luciana, 1º Ten Ana Freixinho, 2º Ten Bertha, 2º Ten Marques, 2º Ten Sarah e 2º Ten Viduani.

Aos meus familiares,

Meus avós (in memoriam), tios e primos (que são muitos!) Meus pais Arlete e Pedro,

Meu irmão Maurício, minha cunhada Tatiana e a minha sobrinha/afilhada Luíza (linda do dindo!),

Meu irmão Daniel, minha cunhada Mariana e ao pequeno Dante que ainda nem nasceu mas já é muito amado.

Amo todos, vocês são tudo pra mim! Saudades sempre!

À minha namorada Liana Ferreira,

Ela que tem a difícil missão de me aturar todos os dias!

Obrigado por cruzar minha vida, seus sorrisos alteram minha percepção de tempo e fazem com que os anos passem voando!

Agradeço também pelo carinho que recebo da sua família: Dona Nilzinha, Seu Zé, Guilherme e Andrea, Guilherminho e Luíza. Sem esquecer de todos os tios e primos que tenho dificuldade de memorizar os nomes!

Àqueles que esqueci de citar nesses agradecimentos,

Não fiquem chateados, seu amigo aqui tem dificuldade até em lembrar o que comeu ontem! Beijos e abraços a todos!

Por fim, agradeço as pessoas que, de uma forma ou de outra, colaboraram em minha formação e crescimento pessoal e profissional.

(11)
(12)

A formação de biofilme in vitro pode ser influenciada pelas características da cepa, tempo de incubação e disponibilidade de nutrientes como a glicose, que regula a produção de biofilme de diversas espécies, incluindo Enterococcus faecalis - espécie bacteriana mais frequentemente relacionada ao insucesso endodôntico. A capacidade de penetrar em túbulos dentinários e formar biofilme são fundamentais em sua resistência ao pH elevado de agentes antimicrobianos utilizados no tratamento endodôntico. Mudanças na taxa de crescimento, na expressão gênica e fenotípica são características dos biofilmes. Este estudo in vitro teve o objetivo de avaliar e comparar a formação de biofilmes de três cepas de E. faecalis em diferentes concentrações de glicose; e avaliar a viabilidade celular e a expressão do gene de divisão celular, ftsZ, de biofilmes maduros de E. faecalis em desafio alcalino. Métodos: A formação de biofilme pelas cepas ATCC 29212, GS12 e JH2-2 em meio TSB suplementado por 0%, 0.5%, 1% e 2% de glicose foi avaliada pela mensuração das densidades óticas (OD) em cristal violeta ao longo de 7 dias. Na sequência, biofilmes maduros de E. faecalis GS12 foram incubados por 7 dias em meio TSB (+2% glicose) ajustado ao pH 7, 10, 11, e 12. No decorrer dess período, a viabilidade celular e a expressão do gene ftsZ foram analisadas por microscopia confocal e qPCR. Resultados: As cepas apresentaram capacidade de formação de biofilme distintas (p<0.05). E. faecalis ATCC 29212 e JH2-2 não formaram biofilme em TSB sem adição de glucose (OD570 < 0,3). E. faecalis GS12 demostrou maior biomassa em todos os momentos e

sob todas as concentrações de glicose (p<0.001). Após 24 h em meio alcalino, todos os grupos experimentais apresentaram uma redução de volume (p<0.05). Em pH 7, a maioria das células permaneceram viáveis durante todo o período experimental (90% ± 0.06%). Em pH 10, não houve diferença na proporção de células vivas/mortas no 5º dia, no 7º dia poucas células permaneceram viáveis (p<0.05). Em pH 11 e 12, o volume dos biofilmes foi majoritariamente composto por células mortas em qualquer momento da análise. A expressão do gene ftsZ permaneceu inalterada durante todo o período experimental nas amostras de biofilmes em pH 7 e pH 10. Biofilmes em pH 11 e pH 12 não produziram amplicons. Conclusão: A formação de biofime de E. faecalis in vitro é dependente tanto da cepa quanto da concentração de glicose presente no meio. E. faecalis, GS12 exibiu maior habilidade em formar biofilme. E.

(13)

do biofilme maduro de E. faecalis de forma dependente da concentração e do tempo de exposição. Níveis de transcritos do gene ftsZ em biofilmes maduros de E. faecalis permanecem inalterados ao longo de 7 dias em pH 7 e pH 10.

Palavras-chaves: Biofilmes, Enterococcus faecalis, glicose, aumento de pH, viabilidade celular, expressão gênica, divisão celular.

(14)

Biofilm formation in vitro is likely influenced by factors that include the intrinsic characteristics of the strain, the incubation period and nutrient availability such as glucose that regulates biofilm production among many species including Enterococcus faecalis – bacterial species most frequently related to endodontic failure. The ability to penetrate into dentinal tubules and form biofilms are essential features to withstand the high pH of antimicrobial agents used during endodontic treatment. Changes in growth rate, gene expression and phenotype are usual features in biofilm life style. This in vitro study aimed to evaluate and compare the biofilm growth of three E. faecalis strains in different glucose concentrations; and to analyzed cell survival and expression of ftsZ, a cell division gene, in mature E. faecalis biofilms in alkaline stress. Methods: The biofilm growth of E. faecalis ATCC 29212, GS12 and JH2-2 was assessed with crystal violet assay by measuring optical densities during 7 days of incubation in TSB medium supplemented with 0% , 0.5%, 1% and 2% glucose. Afterwards, mature E. faecalis GS12 biofilms were incubated for 7 days in TSB (+2% glucose) and adjusted to pH 7, 10, 11, and 12. Along this period, cell viability and ftsZ gene expression were analyzed by confocal microscopy and qPCR. Results: The strains had significantly different biofilm-forming ability (p<0.05). E. faecalis ATCC 29212 and JH2-2 did not form biofilm in TSB medium without additional glucose supplementation (OD570 < 0,3). E. faecalis GS12 presented the greatest biomass at all

time points and under any glucose concentration (p<0.001). In the first 24 h of alkaline challenge, all experimental groups presented a significant reduction on biofilm volume (p < 0.05). At pH 7, most of biofilm cells remained viable throughout the experimental period (90% ± 0.06%). At pH 10, no difference in proportion of live/dead cells was observed by the 5th day, by the 7th day there were few remaining live cells (p<.05). At

pH 11 and pH 12, most biovolume was composed of dead cells at any time point. The expression of ftsZ gene remained unaltered throughout the experimental period in biofilm samples exposed to pH 7 and pH 10. Biofilms exposure to pH 12 and PH 11 produced no amplicon. Conclusion: E. faecalis biofilm formation in vitro is strain- and glucose-dependent. E. faecalis GS12 presented the greatest biofilm formation ability among the analyzed strains. E. faecalis ATCC 29212 and JH2-2 have a limited capacity to form biofilm over 7 days of incubation. Alkaline environment affected

(15)

faecalis biofilms at pH 7 and pH 10 over 7 days.

Key Words: Biofilms, Enterococcus faecalis, glucose, alkalinization, cell survival, gene expression, cell division.

(16)

1 INTRODUÇÃO ... 17

2 ARTIGOS ... 23

2.1 Artigo - Strain variation in Enterococcus faecalis biofilm formation when grown in different glucose concentrations. ... 23

2.2 Artigo – Cell viability and ftsZ gene expression of Enterococcus faecalis biofilms exposed to alkaline pH. ... 33

3 DISCUSSÃO ... 48

4 CONCLUSÃO ... 54

REFERÊNCIAS* ... 55

APÊNDICE 1 – Detalhamento da metodologia ... 62

ANEXO 1 – Documento para fins de comprovação de submissão do artigo ... 69

(17)

1 INTRODUÇÃO

O objetivo do tratamento endodôntico em canais radiculares contaminados é eliminar a infecção do sistema de canais radiculares e prevenir sua recontaminação por meio da obturação. Deste modo, o tratamento endodôntico fornece condições favoráveis para a manutenção ou o reparo dos tecidos periapicais (Kakehashi et al., 1965; Sundqvist et al., 1998; Stuart et al., 2006). Contudo, mesmo quando obedecidos criteriosamente os padrões técnicos de tratamento, estima-se que a completa eliminação dos microrganismos que infectam o sistema de canais radiculares é raramente alcançada pelo preparo químico-mecânico e medicação intracanal (Bystrom et al., 1985; Siqueira e Rôças, 2008).

Estudos sobre a taxa de sucesso em tratamentos e retratamentos endodônticos não cirúrgicos exibem valores que variam de 31% a 100% de sucesso (Ng et al., 2007; Imura et al. 2007; Ng et al., 2008a; Ng et al., 2008b). Segundo os estudos incluídos nas revisões sistemáticas realizadas por Ng et al. (2007; 2008b), entre 68% e 85% dos tratamentos de infecções endodônticas primárias obtiveram total reparo após um período de 1 ano. Números semelhantes foram observados em retratamentos, cujo sucesso variou de 70% a 86% dos casos (Ng et al., 2008a). Dentre as principais causas relacionadas ao insucesso, destacam-se as contaminações secundárias via infiltrações coronárias e a permanência de microrganismos no interior do canal, mesmo após o tratamento (Ray e Trope, 1995; Siqueira, 2001). Isso reforça a dificuldade em alcançar a completa desinfecção do sistema de canais radiculares.

Nesse sentido, a habilidade bacteriana de se organizar em biofilme é de grande interesse terapêutico em endodontia. Sabe-se que bactérias planctônicas presentes no canal principal são mais facilmente acessadas e eliminadas pela a ação dos instrumentos e substâncias químicas auxiliares durante o tratamento endodôntico. Por outro lado, aquelas organizadas em biofilme, aderidas às paredes radiculares em regiões de istmos, ramificações ou no interior de túbulos dentinários são definitivamente mais difíceis de serem alcançadas (Ricucci e Siqueira, 2010). A literatura demonstra que, mesmo nos canais principais, biofilmes podem permanecer intocados pelos instrumentos especialmente em casos de canais irregulares, achatados ou com secção transversal ovalada (Siqueira et al., 1997; Paqué et al., 2010).

(18)

Biofilmes, por definição, são comunidades microbianas sésseis compostas por células firmemente aderidas a um substrato, uma interface ou umas às outras; incorporadas a uma matriz extracelular polimérica produzida por elas mesmas e caracterizada por alterações da taxa de crescimento e transcrição gênica (Donlan e Costerton, 2002). Este estilo de vida é predominante entre procariotas e um padrão entre algumas espécies bacterianas (Donlan e Costerton, 2002; Jefferson, 2004). Embora sejam geralmente formados por comunidades microbianas mistas, os biofilmes podem também ser constituídos por uma única espécie (Stoodley, et al., 2002). De acordo com o “National Institutes of Health” (NIH), os biofilmes microbianos estão envolvidos em cerca de 80% das infecções humanas (Joo e Otto, 2012). As condições em que esses biofilmes são formados no interior dos canais radiculares ainda não são bem compreendidas (Svensater e Bergenholtz, 2004), contudo, infecções primárias, secundárias e persistentes abrigam uma alta prevalência de biofilme bacteriano (Ricucci e Siqueira, 2010).

Ao avaliar histologicamente o segmento apical de dentes com canais radiculares tratados e não-tratados endodonticamente, com expressão radiográfica de periodontite apical, Ricucci e Siqueira (2010) observaram a presença de biofilmes intrarradiculares em 77% dos casos (não-tratados: 80%; tratados: 74%). Esses números variaram com o tamanho (≤5mm: 62%; >5mm: 82%; ≥10mm: 100%) e o tipo de lesão (Cistos: 95%; Abscessos: 85%; Granulomas: 69,5%). Além dos canais principais, os autores puderam observar biofilmes cobrindo ramificações, istmos e penetrando túbulos dentinários. Em 6% dos casos, biofilmes foram encontrados também na superfície extrarradicular associados, geralmente, a infecção no interior do canal radicular de dentes sintomáticos (Ricucci e Siqueira, 2010).

Existem evidências consideráveis que as propriedades fisiológicas das bactérias são alteradas quando em biofilme. A adesão a uma superfície engatilha alterações na expressão de um grande número de genes e seus fenótipos. Dessa forma, os microrganismos assumem um maior potencial patogênico quando comparados àqueles em estado planctônico. Nesse sentido, os mecanismos de defesa do hospedeiro e os tratamentos antimicrobianos químicos e mecânicos têm uma tarefa mais difícil ao lidar com os microrganismos nessa forma de desenvolvimento (Svensater e Bergenholtz, 2004).

(19)

O arranjo em comunidade proporciona vantagens na competição entre os microrganismos: 1) aumentando a diversidade e eficiência metabólica, o que permite a degradação de grandes complexos moleculares, 2) reforçando a proteção diante das defesas do hospedeiro, de agentes antimicrobianos e sob influências adversas do meio e, 3) provocando um aumento na patogenicidade (Marsh, 2005). Bactérias crescendo em biofilme possuem resistência adicional a agentes antimicrobianos. A concentração inibitória mínima (MIC) e a concentração bactericida mínima (MBC) de antibióticos podem atingir valores 100 a 1000 vezes maiores em um biofilme do que em seu correspondente planctônico (Ceri et al., 1999; Haussler e Fuqua, 2013).

Enterococcus faecalis é um habitante comum do trato gastrointestinal e geniturinário relacionado com a maioria das infecções enterocócicas (Tannock e Cook, 2002). A diversidade entre as cepas de E. faecalis permite que essa espécie colonize uma variedade de locais no corpo humano, em outros animais e em nichos ambientais (Fisher e Phillips, 2009). Em endodontia, E. faecalis é descrito como a espécie mais frequentemente encontrada em canais radiculares de casos de insucesso no tratamento endodôntico (Pinheiro et al., 2003; Siqueira e Rôças, 2004; Gomes et al., 2006; Gomes et al., 2008). Em estudos envolvendo métodos de cultura, sua prevalência no insucesso endodôntico alcança até 52% dos casos (Pinheiro et al., 2003; Gomes et al., 2006). Esse número pode ser ainda maior quando utilizados métodos moleculares, mais sensíveis à detecção (Siqueira e Rôças, 2004; Johnson et al., 2006; Sedgley et al., 2006; Gomes et al., 2008).

Siqueira e Roças (2004) ao investigar a composição microbiana de 22 casos de insucesso no tratamento endodôntico pelo método molecular de reação em cadeia da polimerase (PCR) observaram a presença de E. faecalis em 77% dos casos. Número semelhante foi encontrado por Gomes et al. (2008) ao avaliar 45 casos de insucesso pelo mesmo método (77,8%). Sedgley (2006) observou uma prevalência ainda maior (89,6%) ao avaliar esses casos de insucesso em “Real Time - quantitative PCR”.

E. faecalis conta com a capacidade de penetrar em túbulos dentinários (Orstavik e Haapasalo, 1990) e se aderir as paredes radiculares formando biofilme (Mohamed e Huang, 2007), atributos que podem lhe conferir vantagens ecológicas em diversas situações. Este microrganismo é também capaz de resistir a condições ambientais adversas como às promovidas pelo elevado pH do hidróxido de cálcio

(20)

(Flahaut et al., 1997; Ran et al., 2013), substância mais utilizada como medicação intracanal em endodontia. Flahaut et al. (1997) observaram que quando submetido a um período de adaptação de 30 min. em pH 10,5, E. faecalis foi capaz de tolerar pH maiores que 11. Ran et al. (2013) ao avaliarem a formação de biofilmes de E. faecalis em ambiente alcalino também observaram a tolerância desse microrganismo ao pH 11. Sundqvist et al. (1998) mostram que E. faecalis pode ser facilmente eliminado quando em pequeno número, entretanto, uma vez estabelecido no sistema de canais radiculares se torna um microrganismo de difícil erradicação. Essas características associadas a capacidade de se desenvolver em inúmeras condições laboratoriais (Ran et al., 2013) fez com que E. faecalis se tornasse o principal microrganismo utilizado para testar irrigantes, medicamentos e soluções antissépticas em estudos ex vivo e in vitro em endodontia (Chávez de Paz, 2007).

A grande maioria desses estudos se concentram no uso da cepa referência, E. faecalis ATCC 29212 (George, et al., 2005; Baca, et al., 2012; Guerreiro-Tanomaru, et al., 2013). Contudo, sabe-se a capacidade de formação de biofilme pode variar entre cepas de uma mesma espécie devido as suas características intrínsecas (Mohamed et al., 2004; Duggan e Sedgley, 2007; Wang et al., 2011). Mohamed et al. (2004) avaliaram 79 cepas clínicas de E. faecalis de origem em endocardites. Embora todas demonstraram ser capazes de formar biofilme, 39% delas apresentaram um grande potencial de formação, 52% revelaram um potencial moderado enquanto 9% tiveram uma limitada formação de biofilme. Duggan e Sedgley (2007) ao investigar a capacidade de formação de biofilme entre cepas clínicas de origem na cavidade oral e em canais radiculares também observaram diferentes potenciais de formação de biofilme. Em seu estudo, 18% das cepas de origem endodôntica apresentaram grande potencial de formação de biofilme.

A formação de biofilme in vitro pode ser influenciada por diversos fatores como as características intrínsecas da cepa, o tipo de superfície, o tempo de incubação e a disponibilidade de nutrientes (Sandoe, et al., 2003; Mohamed, et al., 2004; Duggan, and Sedgley, 2007; Seneviratne, et al., 2013; Guerreiro-Tanomaru, et al., 2013). O metabolismo de carboidratos, como a glicose, regula a produção de biofilme de diversas bactérias, inclusive a de E. faecalis (Baldassarri, et al., 2001; Kristich, et al., 2004). Estudos relacionam a suplementação de glicose ao meio de cultura com o aumento na formação de biofilme (Baldassarri, et al., 2001), enquanto

(21)

outros apontam que uma disponibilidade de glicose pode inibir essa formação(Kristich, et al., 2004).

Tanto na forma planctônica como em biofilmes o desenvolvimento dos microrganismos requer divisão celular. FtsZ é uma proteína homóloga a tubulina que desempenha um papel importante na divisão celular dos procariotas (Lutkenhaus e Addinall, 1997). Esta proteína é uma das primeiras a se posicionar no local em que ocorre a divisão celular e compõe uma estrutura chamada “anel FtsZ” ou “anel Z” (Margolin, 2015). É o anel Z que define o local e o momento em que o septo para divisão celular é formado. Sua formação é decorrente de tendências intrínsecas da FtsZ de polimerizar-se e da ação de proteínas moduladoras capazes de estimular ou inibir a polimerização da FtsZ (Lutkenhaus, and Addinall, 1997).

Uma das primeiras indicações de que FtsZ desempenha um papel fundamental na divisão celular veio de estudos que envolveram o aumento da expressão do gene ftsZ. Este aumento produziu uma consequente elevação nos níveis da proteína FtsZ. Alguns estudos relatam que a expressão do gene ftsZ e a formação do “anel FtsZ” está sujeita a uma regulação dependente da taxa de crescimento (Garrido, et al., 1993; Joseleau-petit, et al., 1999). Outros colocam que esse fenômeno pode fazer com que a divisão ocorra nos polos celulares, formando células filhas assimétricas, com dimensões reduzidas e/ou irregulares (Ward e Lutkenhaus, 1985; Lutkenhaus e Addinall, 1997). Em um estudo realizado por Appelbe e Sedgley (2007), células planctônicas de E. faecalis apresentaram um aumento de 37 vezes na transcrição do gene ftsZ após 5 dias de exposição ao pH 10 (37⁰C). Ran et al. (2013) também observaram um aumento na transcrição do gene ftsZ (mais de 10 vezes em pH 10 e mais de 100 vezes em pH 11) ao avaliar a formação de biofilme de E. faecalis em pH alcalino por 24 h e 48 h. Em microscopia eletrônica de transmissão, as células sob estresse alcalino apresentavam morfologia irregular com defeitos na divisão e perda de simetria.

Não obstante, um dos preceitos da vida bacteriana planctônica de direcionar a energia proveniente dos nutrientes para reprodução pode não se aplicar a biofilmes bacterianos maduros, cuja divisão celular é menos frequente. A energia, nesses casos, é direcionada a produção da matriz extracelular, substância que as células do biofilme podem utilizar como nutriente em momentos de necessidade (Watnick e Kolter, 2000). Da mesma forma, se dividir ou não é uma resolução celular

(22)

importante, especialmente para bactérias que estão expostas a mudanças ambientais drásticas. Em condições adversas, o crescimento e a proliferação pode comprometer a integridade celular. Para este fim, as bactérias desenvolveram mecanismos sofisticados para traduzir informação ambientais em controle do ciclo celular (Jonas, 2014).

Em suma, nem todas as cepas de uma espécie se comportam de maneira similar. A formação de biofilme in vitro pode ser influenciada por diversos fatores como as características intrínsecas da cepa, o tipo de superfície, o tempo de incubação e a disponibilidade de nutrientes como a glicose, que regula a produção de biofilme de diversas bactérias, incluindo E. faecalis. E. faecalis é a espécie bacteriana mais frequentemente encontrada diante do insucesso endodôntico. Sua capacidade de penetrar em túbulos dentinários, aderir às paredes radiculares e formar biofilme são apontadas como os principais fatores responsáveis por sua resistência a condições ambientais adversas como o pH elevado de agentes antimicrobianos utilizados durante o tratamento. Este estilo de vida microbiano caracteriza-se por mudanças na taxa de crescimento e na expressão de genes e seus fenótipos. Um melhor entendimento dos meios pelos quais E. faecalis forma biofilme e é capaz de sobreviver à terapêutica endodôntica pode produzir fundamentos para estudos futuros e contribuir no aprimoramento de protocolos de tratamento em endodontia.

Em vista disso, o presente estudo é dividido em dois capítulos com os seguintes objetivos: Capítulo 1 - avaliar e comparar a dinâmica de formação de biofilmes da cepa referência E. faecalis ATCC 29212 com a cepa laboratorial E. faecalis JH2-2 e a cepa clínica coletada de um retratamento endodôntico E. faecalis GS12 em diferentes concentrações de glicose; Capítulo 2 - avaliar a viabilidade celular e a expressão do gene de divisão celular, ftsZ, de biofilmes maduros de E. faecalis em situação de estresse alcalino.

(23)

2 ARTIGOS

2.1 ARTIGO - Strain variation in Enterococcus faecalis biofilm formation when grown in different glucose concentrations.

*Este artigo foi submetido a revista Brazilian Oral Research (Anexo 1)

ABSTRACT

E. faecalis is frequently recovered from the root canals of endodontically treated teeth undergoing retreatment. Investigations on the antimicrobial activity of agents for use in endodontic treatment have typically utilized E. faecalis ATCC 29212, a strain recovered from urine. The aim of this study was to evaluate and compare biofilm production by E. faecalis ATCC 29212 with a strain recovered from an endodontic retreatment case (GS12), and a laboratory strain (JH2-2) when strains were exposed to different glucose concentrations. Biofilms were grown on polystyrene in tryptic soy broth (TSB) supplemented with additional glucose (0%, 0.5%, 1% and 2%) at 37°C under aerobic conditions. After 24 h, 48 h, 72 h, 5 days and 7 days, biofilm mass was measured by using a crystal violet assay and a microtiter plate reader at an optical density of 570 nm. There was a significant difference between the three strains in their biofilm production (p<0.05). E. faecalis GS12 produced the densest biomass at all time points and under all glucose concentrations (p<0.001). Increased glucose availability was positively correlated with increased biofilm production for E. faecalis GS12 (p<0.05). E. faecalis ATCC 29212 and JH2-2 did not form biofilms unless additional glucose was provided. The extent of E. faecalis biofilm formation in vitro is strain- and glucose-dependent. E. faecalis GS12 presented the greatest biofilm formation ability among the analyzed strains. E. faecalis ATCC 29212 and JH2-2 demonstrated a limited capacity to form biofilm over 7 days of incubation.

(24)

INTRODUCTION

Biofilms are sessile microbial communities composed by cells firmly attached to a substratum or an interface or to each other; embedded in a polymeric extracellular matrix produced by themselves and characterized by changes in growth rate and gene transcription.1 They have been described as the default mode of growth

for some bacterial species2 and a predominant lifestyle among bacteria in nature.1

Biofilms typically consist of a mixed bacterial community, but also can be found as a single species population.3 According to Joo and Otto,4 estimates for the percentage

of bacterial infections in humans involving biofilms is ~65% (Centers for Disease Control) and 80% (National Institutes of Health). Untreated and treated teeth with apical periodontitis revealed a high prevalence of bacterial biofilms at the apical third, 80% and 74%, respectively.5

Enterococcus faecalis is a common inhabitant of the human gastrointestinal and genitourinary tract, and is related to the majority of human enterococcal infections.6

It is frequently recovered from the root canals of endodontically treated teeth undergoing retreatment7–10, with prevalence in canals of up to 52% and 90% in studies using culture8,9 and molecular7,10,11 methods, respectively. E. faecalis is capable of

resisting harsh environmental conditions such as those promoted by the high pH of calcium hydroxide.12 The species also shows the ability to penetrate into dentinal

tubules,13 to form biofilm14 and can survive in root filled teeth for extended periods.15

Its recovery from infected root canals, coupled with an ability to readily grow under many laboratory conditions16 has resulted in E. faecalis, in particular the readily

available strain ATCC 29212, becoming a frequent species for testing the antimicrobial efficacy of different irrigants, medicaments, and antiseptic solutions for in vitro endodontic studies.17–20

In fact, not all strains of a species behave similarly21,22 and biofilm formation

in vitro is likely influenced by factors that include the intrinsic characteristics of the strain,21–23 the type of surface,20 the incubation period and nutrient availability.24,25

Carbohydrate metabolism regulates biofilm production among many bacteria including E. faecalis.26,27 Some studies have shown that glucose supplementation enhances E.

faecalis biofilm formation,27 as others have related the glucose availability to a

inhibition of biofilm production.26 A better understanding of the means by which E.

(25)

improve endodontic treatment protocols. Thus, the aim of this in vitro study was to evaluate and compare biofilm production among E. faecalis strains (ATCC 29212, GS12, and JH2-2) grown in different glucose concentrations.

MATERIALS AND METHODS

E. faecalis strains ATCC 29212, JH2-2,28 GS1229 were taken from -80°C

stocks and plated onto Tryptic Soy Broth (TSB, Becton Dickinson and Co, Sparks, MD, USA) supplemented with 1.5% agar and incubated aerobically at 37°C for 24 h. Biofilm Assay

After overnight culture, isolated bacterial colonies were suspended in TSB and adjusted to a concentration of 3.0 X 108 CFU/mL using a calibrated

spectrophotometer (Spectronic 20D, Thermo Electron Corporation, Pittsburgh, PA, USA) at 600 nm wavelength. A 20 µL aliquot of each standardized bacterial suspension was placed into individual wells of flat-bottomed polystyrene 96-well microtiter plates (Corning Costar, Tewksbury, MA, USA). To each inoculated well was added 180 µL of TSB supplemented with either 0%, 0.5%, 1% or 2% glucose (EMD Millipore, Darmstadt, Germany). Wells containing 200 µL of sterile TSB were used as negative growth controls. Plates were incubated at 37°C under aerobic conditions. The medium was completely renewed every 24 h. At time points 24 h, 48 h, 72 h, 5 days and 7 days the optical density (OD) was measured using a crystal violet (CV) assay.25

Quantification of E. faecalis biofilms using crystal violet (CV) assay.

TSB was drawn off by pipetting and biofilm in each well was washed with 200 µL of phosphate-buffered saline (PBS, pH 7.2, Corning, New York, USA). Biofilm was fixed with 200 µL of 1% paraformaldehyde with 1mM CaCl2 in PBS for 15 min,

rinsed with PBS and stained with 200 µL of 0.01% CV for 15 min. Wells were rinsed with PBS and bound CV was dissolved with 200 µL of ethanol-acetone solution (80:20, vol/vol) for 5 min. The OD570 of the released CV was measured using a microtiter plate

reader (Bio-Tek - Synergy HT, Winooski, VT, USA). All experiments were performed in quadruplicate on three different occasions.

(26)

Statistical Analysis

The effects of strain type and glucose concentration were evaluated by using GraphPad Prism software for Macintosh (Version 6.0; GraphPad Software, Inc, San Diego, CA). Normal distribution of data was verified by the D’Agostino and Pearson normality test. Two-way ANOVA and Tukey’s multiple comparisons test of mean OD570 readings were used to analyze the effects of strain and glucose

supplementation. Significance was set at 5%.

RESULTS

OD570 values (mean ± SD) ranged from 0.131 ± 0.017 to 2.689 ± 0.190

(Figure 1). There was a significant difference between the three strains in their biofilm production (p<0.05). For E. faecalis ATCC 29212 OD570 readings ranged from 0.180 ±

0,029 to 0.678 ± 0,156, with maximum biofilm at 72 h in 1% glucose. For E. faecalis JH2-2 OD570 readings ranged from 0.131 ± 0,017 to 0.820 ± 0,223, with maximum

biofilm at 7 days in 2% glucose. For E. faecalis GS12 OD570 readings ranged from

0.683 ± 0,162 to 2.689 ± 0,190 with maximum biofilm at 72 h in 2% glucose. No biofilm was detected in negative growth control wells.

E. faecalis GS12 produced the densest biomass at all time points and under all glucose concentrations (p<0.001). Increased glucose availability was positively correlated with increased biofilm production for E. faecalis GS12 (p<0.05). E. faecalis ATCC 29212 and JH2-2 did not form biofilm when incubated in TSB medium without additional glucose supplementation (OD570 = 0.202 ± 0.035 and 0.167 ± 0.038,

respectively).

DISCUSSION

In vitro studies have shown the capacity for E. faecalis under varying experimental conditions to successfully form biofilms on various surfaces.19,20,25,30 In

this study, the biofilm formation of an E. faecalis reference strain (ATCC 29212) was compared to a laboratory strain JH2-2 (a fusidic acid and rifampin resistant mutant of JH2)28 and a clinical strain recovered from an endodontic retreatment case (GS12).29

Biofilm formation was evaluated by growth over 7 days of incubation in TSB medium with addition of glucose in different concentrations (0%, 0.5%, 1% and 2%).

(27)

In accordance with the classification of Mohamed et al.,22 who evaluated E.

faecalis endocarditis strains, only strains with OD570 readings greater than 0.5 after 24

h incubation would be described as biofilm formers – weak (<1), medium (≤ 2), or strong (>2) biofilm formers. By using these parameters, only E. faecalis GS12 could be categorized as a biofilm former (OD570 = 0.683 ± 0.162). GS12 presented the

densest biomass among the analyzed strains at all time points and under any glucose concentration tested (p<0.001).

E. faecalis ATCC 29212 and JH2-2 did not form biofilm unless additional glucose was provided. It should be noted that, although TSB medium contains glucose (0.25%), this concentration was insufficient to support even “weak” biofilm formation over 7 days of incubation.22 E. faecalis ATCC 29212 is a urine strain used in many

investigations testing endodontic products against planktonic bacteria and biofilms.18–

20 A poor structured biofilm development was also reported by

Guerreiro-Tanomaru et al.20 particularly, during the first few days of incubation. Although ATCC

29212 presented greater biomass growth in supplemented media, the maximum OD570

mean value achieved was only 0.678 ± 0,156. E. faecalis JH2-2 showed an increase in biomass (>0.5) only after 7 days of incubation in supplemented media (maximum OD570 0.820 ± 0.223; TSB+2% Glucose). The limited capacity of JH2-2 to form biofilm

has also been observed by Duggan and Sedgley (OD570 < 0.2).21

The results of this study support others that showed that not all strains of a species behave similarly.21–23 The distinct capacity to form biofilm might be explained by virulence traits identified in some of the strains.22,29,31 Surface proteins such as

aggregation substance (Asa), endocarditis antigen (EfaA), collagen-binding antigen (Ace) and enterococcal surface protein (Esp) were associated with cell adhesion and biofilm formation.29,32–34 A positive correlation between biofilm production and the presence of GelE and its regulatory operon (fsr) was also reported.35,36 E. faecalis

ATCC 29212 is positive for the genes gelE, asa, ace, efaA and negative for esp and the operon fsr.31 E. faecalis GS12 is a gelE, fsr, esp, asa, ace and efaA positive strain29

and E. faecalis JH2-2, on the other hand, is negative for esp and fsr.37

Steps leading to the organization of biofilm structure and the mechanisms behind the influence of glucose supplementation in biofilm growth are still unclear. Studies have reported that glucose may induce the synthesis of virulence traits such as Esp, which promotes the formation of biofilm.33,34 In contrast with Sandoe et al.,24

(28)

who observed thicker E. faecalis biofilm formation when grown under low nutrient (saline) versus nutrient-rich Brain-Heart Infusion (BHI) medium (0.2% glucose) conditions, the present study found that TSB (0.25% glucose) supplemented with additional glucose enhanced biofilm formation (p<0.05). Moreover the increased biofilm biomass was glucose concentration-dependent. The lowest biomass values of each strain were observed when grown in medium without glucose supplementation. Similar findings were reported by Seneviratne et al.,25 who observed that the addition

of 2% glucose enhanced biofilm formation.

At 72 h incubation, E. faecalis GS12 biofilm growing in TSB with the addition of 2% glucose presented the maximum OD570 mean value observed in this study (2.689

± 0.190). At this point, in groups with glucose added, E. faecalis GS12 and ATCC 29212 biofilm growth reached a stationary phase followed by a significant biomass decrease (p<0.05). Similar behavior was also observed by Seneviratne et al.25

Studies evaluating antimicrobial activity of substances in endodontics frequently use the strain E. faecalis ATCC 29212 with varying glucose concentrations and incubation periods. Considering the limited biofilm formation capacity of E. faecalis ATCC 29212, in vitro studies testing the antimicrobial activity of endodontic products against biofilm could reconsider using this strain, and instead utilize multiple clinical strains.

CONCLUSION

The extent of E. faecalis biofilm formation in vitro is strain- and glucose-dependent. E. faecalis GS12 presented the greatest biofilm formation ability among the analyzed strains. E. faecalis ATCC 29212 and JH2-2 demonstrated a limited capacity to form biofilm over 7 days of incubation.

ACKNOWLEDGMENTS

The authors thank Guy Simmons and Dr. Kirsten Lampi for technical support, and CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brazil, processes no. 5626-13-7 and no. 10342-12-5) for financial support. The authors deny any conflicts of interest related to this study.

(29)

REFERENCES

1. Donlan RM, Costerton JW. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev. 2002 Apr;15(2):167–93.

2. Jefferson KK. What drives bacteria to produce a biofilm? FEMS Microbiol Lett. 2004 Jul 15;236(2):163-73.

3. Stoodley P, Sauer K, Davies DG, Costerton JW. Biofilms as complex differentiated communities. Annu Rev Microbiol. 2002;56:187-209.

4. Joo H-S, Otto M. Molecular basis of in vivo biofilm formation by bacterial pathogens. Chem Biol. 2012 Dec;19(12):1503–13.

5. Ricucci D, Siqueira JF. Biofilms and apical periodontitis: study of prevalence and association with clinical and histopathologic findings. J Endod. 2010 Aug;36(8):1277–88.

6. Tannock GW, Cook G. Enterococci as members of the intestinal microflora of humans. In: Gilmore MS, editor. The enterococci: pathogenesis, molecular biology, and antibiotic resistance. Washington, DC: ASM Press; 2002;101–32. 7. Gomes BPF a, Pinheiro ET, Jacinto RC, Zaia A a, Ferraz CCR, Souza-Filho FJ.

Microbial analysis of canals of root-filled teeth with periapical lesions using polymerase chain reaction. J Endod. 2008 May;34(5):537–40.

8. Gomes BPF a, Pinheiro ET, Sousa ELR, Jacinto RC, Zaia A a, Ferraz CCR, et al. Enterococcus faecalis in dental root canals detected by culture and by polymerase chain reaction analysis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006 Aug;102(2):247–53.

9. Pinheiro ET, Gomes BPFA, Ferraz CCR, Sousa ELR, Teixeira FB, Souza-Filho FJ. Microorganisms from canals of root-filled teeth with periapical lesions. Int Endod J. 2003 Jan;36(1):1–11.

10. Siqueira JF, Rôças IN. Polymerase chain reaction-based analysis of microorganisms associated with failed endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2004 Jan;97(1):85–94.

11. Sedgley C, Nagel A, Dahlén G, Reit C, Molander A. Real-time quantitative polymerase chain reaction and culture analyses of Enterococcus faecalis in root canals. J Endod. 2006 Mar;32(3):173-7.

12. Ran S, He Z, Liang J. Survival of Enterococcus faecalis during alkaline stress: Changes in morphology, ultrastructure, physiochemical properties of the cell wall and specific gene transcripts. Arch Oral Biol. 2013 Nov;58(11):1667–76.

13. Orstavik D, Haapasalo M. Disinfection by endodontic irrigants and dressings of experimentally infected dentinal tubules. Endod Dent Traumatol. 1990 Aug;6(4):142–9.

(30)

14. Mohamed JA, Huang DB. Biofilm formation by enterococci. J Med Microbiol. 2007 Dec;56(12):1581–8.

15. Sedgley C, Lennan S AO. Survival of Enterococcus faecalis in root canals ex vivo. Int Endod J. 2005 Oct;38(10):735-42.

16. Ran S, Wang J, Jiang W, Zhu C, Liang J. Assessment of dentinal tubule invasion capacity of Enterococcus faecalis under stress conditions ex vivo. Int Endod J. 2015 Apr;48(4):362-72.

17. Chavez de Paz LE, Chávez de Paz L. Redefining the persistent infection in root canals: possible role of biofilm communities. J Endod. 2007 Jun;33(6):652–62. 18. Baca P, de Freitas MFA, Ferrer-Luque CM, González-Rodríguez MP, Arias-Moliz MT. In vitro enterococcus faecalis biofilm formation on five adhesive systems. Med Oral Patol Oral Cir Bucal. 2012 May 1;17(3):e501-5.

19. George S, Kishen A, Song KP. The role of environmental changes on monospecies biofilm formation on root canal wall by Enterococcus faecalis. J Endod. 2005 Dec;31(12):867-72.

20. Guerreiro-Tanomaru JM, De Faria-Júnior NB, Duarte MAH, Ordinola-Zapata R, Graeff MSZ, Tanomaru-Filho M. Comparative analysis of Enterococcus faecalis biofilm formation on different substrates. J Endod. 2013 Mar;39(3):346–50. 21. Duggan JM, Sedgley CM. Biofilm Formation of Oral and Endodontic

Enterococcus faecalis. J Endod. 2007 Jul;33(7):815–8.

22. Mohamed J a, Huang W, Nallapareddy SR, Teng F, Murray BE. Influence of origin of isolates, especially endocarditis isolates, and various genes on biofilm formation by Enterococcus faecalis. Infect Immun. 2004 Jun;72(6):3658–63. 23. Wang L, Dong M, Zheng J, Song Q, Yin W, Li J, et al. Relationship of biofilm

formation and gelE gene expression in enterococcus faecalis recovered from root canals in patients requiring endodontic retreatment. 2011 May;37(5):631-6. 24. Sandoe JAT, Witherden IR, Cove JH, Heritage J, Wilcox MH. Correlation between enterococcal biofilm formation in vitro and medical-device-related infection potential in vivo. J Med Microbiol. 2003 Jul;52(7):547-50.

25. Seneviratne CJ, Yip JWY, Chang JWW, Zhang CF, Samaranayake LP. Effect of culture media and nutrients on biofilm growth kinetics of laboratory and clinical strains of Enterococcus faecalis. Arch Oral Biol. 2013 Oct;58(10):1327–34. 26. Kristich CJ, Li Y, Cvitkovitch DG, Dunny GM. Esp-Independent Biofilm Formation

by Enterococcus faecalis. 2004 Jan;186(1):154-63.

27. Baldassarri L, Cecchini R, Bertuccini L, Ammendolia MG, Iosi F, Arciola CR, et al. Enterococcus spp. produces slim and survives in rat peritoneal macrophages. Med Microbiol Immunol. 2001 Dec;190(3):113-20.

(31)

28. Jacob AE, Hobbs SJ. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J Bacteriol. 1974 Feb;117(2):360-72.

29. Sedgley CM, Molander A, Flannagan SE, Nagel AC, Appelbe OK, Clewell DB, et al. Virulence, phenotype and genotype characteristics of endodontic Enterococcus spp. Oral Microbiol Immunol. 2005 Feb;20(1):10-9.

30. Williamson AE, Cardon JW, Drake DR. Antimicrobial Susceptibility of Monoculture Biofilms of a Clinical Isolate of Enterococcus faecalis. J Endod. 2009 Jan;35(1):95-7.

31. Zhu X, Wang Q, Zhang C, Cheung GSP, Shen Y. Prevalence, phenotype, and genotype of enterococcus faecalis isolated from saliva and root canals in patients with persistent apical periodontitis. J Endod. 2010 Dec;36(12):1950-5. 32. Kowalski WJ, Kasper EL, Hatton JF, Murray BE, Nallapareddy SR, Gillespie MJ.

Enterococcus faecalis Adhesin, Ace, Mediates Attachment to Particulate Dentin. J Endod. 2006 Jul;32(7):634-7.

33. Tendolkar PM, Baghdayan AS, Gilmore MS, Shankar N. Enterococcal surface protein, Esp, enhances biofilm formation by Enterococcus faecalis. Infect Immun. 2004 Oct;72(10):6032-9.

34. Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C, Lamata M, et al. The Enterococcal Surface Protein, Esp, Is Involved in Enterococcus faecalis Biofilm Formation. Appl Environ Microbiol. 2001 Oct;67(10):4538-45.

35. Nakayama J, Chen S, Oyama N, Nishiguchi K, Azab EA, Tanaka E, et al. Revised model for Enterococcus faecalis fsr quorum-sensing system: The small open reading frame fsrD encodes the gelatinase biosynthesis-activating pheromone propeptide corresponding to staphylococcal AgrD. J Bacteriol. 2006 Dec;188(23):8321-6.

36. Shepard BD, Gilmore MS. Differential expression of virulence-related genes in Enterococcus faecalis in response to biological cues in serum and urine. Infect Immun. 2002 Aug;70(8):4344-52.

37. La Rosa SL, Snipen LG, Murray BE, Willems RJ, Gilmore MS, Diep DB, et al. A Genomic Virulence Reference Map of Enterococcus faecalis Reveals an Important Contribution of Phage03-Like Elements in Nosocomial Genetic Lineages to Pathogenicity in a Caenorhabditis elegans Infection Model. 2015 May;83(5):2156-67.

(32)

Figures

Figure 1. Biofilm OD570 readings (mean ± SD) of E. faecalis strains ATCC 29212, GS12 and

JH2-2 grown in TSB with 0% (No glucose added), 0.5%, 1% and 2% glucose supplementation over 7 days.

(33)

2.2 ARTIGO – Cell viability and ftsZ gene expression of Enterococcus faecalis biofilms exposed to alkaline pH.

*Este artigo será submetido ao periódico Journal of Endodontics

ABSTRACT

Introduction: The persistence of Enterococcus faecalis in treated root canals has been attributed to survival mechanisms that include resistance to the high pH of antimicrobial agents used during treatment. This study evaluated the cell survival and expression of ftsZ, a cell division gene, in mature E. faecalis biofilms exposed to alkaline stress. Methods: Seventy-two hours E. faecalis GS12 biofilms exposed to pH 7, 10, 11, and 12 were assessed for cell viability and ftsZ gene expression at 24 h, 48 h, 72 h, 5 days and 7 days by using Live/Dead stain under confocal laser scanning microscopy and qPCR, respectively. Results: Biofilm volume reduced significantly in the first 24 h in all experimental groups (p < 0.05). At pH 7, most cells remained viable throughout the entire experiment (90% ± 0.06%). At pH 10, no difference in proportion of live/dead cells was observed by the 5th day, but by the 7th day there were few

remaining live cells (p<.05). At pH 11 and pH 12, most biovolume was composed of dead cells (95.7% ± 4.53% and 87.5% ± 10.38%, respectively) at any time point (p<.05). The expression of ftsZ in E. faecalis biofilm at pH 7 and pH 10 remained unaltered. No amplification was observed for pH 11 and pH 12. Conclusion: Alkaline environment affected E. faecalis GS12 biofilm structure and biofilm cell viability in a concentration- and time-dependent manners. Transcript levels of ftsZ gene remained unaltered at pH 7 and pH 10.

Key words: Alkaline pH, biofilm, cell viability, Enterococcus faecalis, ftsZ gene expression.

(34)

INTRODUCTION

Biofilms are complex communities of aggregated bacteria embedded in a self-secreted polymeric extracellular matrix and are characterized by changes in cells phenotype with respect to growth rate and gene transcription (1). The biofilm structure provides a successful strategy for bacteria to resist antimicrobial agents (2). When harbored in inaccessible anatomical niches such as isthmus, apical ramifications and lateral canals biofilms are difficult to eradicate (3,4). Both untreated and treated teeth with apical periodontitis revealed a high prevalence of bacterial biofilms at the apical third, 80% and 74%, respectively (5). Thus, the ability of bacteria to grow in a biofilm organization has been identified as a key factor in persistence of infections and bacterial recolonization after endodontic treatment (5,6).

Enterococcus faecalis is frequently recovered from root canals of teeth with failed root canal treatment, with prevalence reports of up to 90% of cases (7). The observed survival of E. faecalis in treated root canals can be attributed to several mechanisms including the capacity to resist adverse environmental conditions (8). These include the high pH of antimicrobial agents commonly used during treatment, in particular calcium hydroxide (pH<12) (3,9), as well as the ability of E. faecalis to adhere, colonize, and form biofilms on root canal walls, apical cementum, gutta-percha, and endodontic sealers (10,11).

Biofilms form in multiple steps that require intercellular signaling, and demonstrate a gene transcription profile that is distinct from that of planktonic cells (12). FtsZ is a prokaryotic cytoskeleton protein that plays a vital role in cell division by recruiting and serving as a scaffold for other division proteins (13,14). A previous study showed that E. faecalis JH2-2 grown under planktonic conditions at pH 10 at 37°C exhibited a 37-fold increase in ftsZ gene expression after 120 h (15). Similarly, Ran et al. (16) reported that E. faecalis biofilms developed in 24 h and 48 h culture at alkaline medium increased transcription of ftsZ by over 10 times at pH 10 and over 100 times at pH 11. However, the cell viability and expression of ftsZ in mature biofilms under stress caused by exposure to high pH has not been investigated. Hence, considering that the persistence of endodontic infections may be related to well establish biofilms, the aim of this study was to evaluate the survival and ftsZ gene expression in mature E. faecalis biofilms maintained in high pH conditions.

(35)

MATERIALS AND METHODS

E. faecalis GS12, a strain recovered from an endodontically treated tooth (17) was grown from -80C stocks and plated onto Tryptic Soy Broth (TSB, Becton Dickinson and Co, Sparks, MD, USA) supplemented with 1.5% agar and incubated aerobically at 37C for 24 h. A standardized bacterial suspension was prepared in TSB supplemented with 2% glucose (TSBg) (EMD Millipore, Darmstadt, Germany) and adjusted to 3.0 X 108 CFU/mL using a calibrated spectrophotometer (Spectronic 20D,

Thermo Electron Corporation, Pittsburgh, PA, USA) at 600 nm wavelength. Bacteria were grown under aerobic conditions at 37°C for all experiments.

Buffered TSBg solutions were prepared by mixing 0.2 M KH2PO4 and 0.2 M

KOH for pH 7; 0.2 M NaHCO3 and 0.2 M KOH for pH10; 0.2 M Na2HPO4 and KOH for

pH 11; and 0.2 M KOH for pH 12 (18). Monitoring of pH was maintained throughout all experiments.

Cell viability of E. faecalis biofilms

Sterile hydroxyapatite (HA) disks (10 mm diameter and 2 mm thick; Clarkson Chromatography Products, Williamsport, PA) were coated with bovine dermal type I collagen (10 mg/mL collagen and 0.012 N HCl in sterile water) (Gibco, Life Technologies, Grand Island, NY, USA), for use as a biofilm substrate. The collagen coating of the HA disks (CHAs) was performed by overnight incubation at 4°C in a 35 mm plastic petri dish containing 2 mL of the collagen solution as described elsewhere (19).

CHAs were placed into the wells of flat-bottomed polystyrene 24-well microtiter plates with a 200 µL aliquot of the standardized bacterial suspension and 1.8 mL of TSBg. Media was renewed every 24 h. Plates were incubated for 72 h after which media was drawn off and biofilms were washed once with 2 mL of phosphate-buffered saline (PBS, pH 7.2). To each well was added 2 mL of phosphate-buffered TSBg solutions according to allocated pH (7, 10, 11, or 12) and plates were incubated aerobically at 37°C. Media was renewed every 24 h. Wells containing unbuffered TSBg (pH 6.52) served as positive controls for biofilm growth, and sterile TSBg served as negative controls. Experiments were performed in triplicate on three separate occasions.

(36)

CHAs were harvested at time 0 (72 h biofilm), and thereafter at 24 h, 48 h, 72 h, 5 days and 7 days, for confocal laser scanning microscope (CLSM) imaging to evaluate biofilm viability and morphology. Media was drawn off and each well was washed with 2 mL of PBS. CHAs were transferred to a glass slab. Biofilms were stained with SYTO-9 and propidium iodide (PI) Live/Dead reagents (BacLight Viability kit; Thermo Fisher Scientific, Waltham, MA, USA) (11) and examined under a CLSM (Zeiss/Bio-Rad Radiance 2100 laser scanning system mounted on a Nikon E800 upright microscope) at X 40 magnification. Simultaneous two-channel imaging using 488 and 543 nm excitation was used to detect SYTO-9 (500-560 nm emission) and PI (650 nm emission). Confocal z-series composed by 16 image slices with 2 µm intervals were acquired from nine fields of view with zoom factor of 1.0, pixel resolution of 0.55 µm/pixel, and field resolution of 512 x 512 pixels. Individual biofilm images covered an area of 275 µm2 per field of view. Confocal z-series were converted to TIFF

image stacks using ImageJ (http://rsb.info.nih.gov/ij/). The image projections of z-series were transferred to BioImage_L Software (20) to evaluate total biovolume (µm3),

green biovolume (µm3), and substrate coverage (%).

Quantification of ftsZ gene expression

A 2 mL aliquot of the standardized bacterial suspension was placed into 90 mm polystyrene culture plates containing 18 mL of TSBg. Media was renewed every 24 h. Plates were incubated for 72 h after which the media was drawn off and biofilms were washed once with 20 mL PBS. Plates were filled with 20 mL of buffered TSBg solutions according to allocated pH (7, 10, 11, or 12) and plates were incubated. Media was renewed every 24 h. At time 0 (72 h biofilm), 24 h, 48 h, 72 h, 5 days and 7 days media was drawn off. Biofilms were washed once with 20 mL PBS and harvested by scraping (Cell scraper, Fisher Scientific International Inc., Hampton, NH, USA) and stored in RNAlater solution (Ambion, Austin, TX, USA) at -20C. Plates with unbuffered TSBg (pH 6.52) were used as positive controls for biofilm growth, and sterile TSBg served as negative controls. Experiments were performed in triplicate on three separate occasions.

RNA extraction and reverse transcription was performed as described elsewhere (21). Quantitative PCR assays were performed using SYBR Select Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on a DNA Engine Opticon 2 System

(37)

(Bio-Rad). Based on the final cDNA concentrations, 10 ng of cDNA samples were added to the reactions with 10 µL of SYBR Select Master Mix, 0.3125 µM of each primer and water to complete a total reaction volume of 20 µL. Reactions were submitted to an uracil-DNA glycosylase (UDG) activation at 50°C for 2 min, and an initial denaturation at 95°C for 2 min followed by 40 cycles of 95°C for 10 s, 60°C for 30 s. A standard melting curve was used to check the quality of the amplification and to ensure specificity. The reference gene, 23S, was used as an internal control to which the expression of ftsZ gene was normalized. Fold changes in the levels of transcripts for each pH at each time point were determined using the 2-ΔΔCT method (22). Experiments were performed in triplicate on three separate occasions.

Primers

Primers were synthesized by Invitrogen (Eugene, OR). The primer sequences for ftsZ gene were: EfftsZ F: 5’ CCGTCAAACAAGACAAGCGG 3’ and EfftsZ R: 5’ TCCCAATCGCCAAAAGCACT 3’. The primer sequences for the reference gene 23S were: Ef23S F, 5’- CCTATCGGCCTCGGCTTAG-3’ and Ef23S R, 5’- AGCGAAAGACAGGTGAGAATCC-3’. The sizes of PCR amplicons were 105 bp and 101 bp, respectively (16).

Statistical Analysis

Statistical analysis was performed on GraphPad Prism software for Windows (Version 6.0; GraphPad Software, Inc, San Diego, CA). Distribution of data was verified by the Kolmogorov-Smirnov test. The two-way ANOVA with Tukey’s multiple comparison test or Kruskal-Wallis test with Dunn post hoc tests were used when appropriated to compare confocal and qPCR data. Significance was set at 5% RESULTS

Biofilm growth on HA discs

Figure 1 shows representative CLSM images of E. faecalis GS12 biofilm viability and substrate coverage at each pH and incubation period. Values for mean biofilm volume (μm3) of live and dead cells at each pH and incubation period are shown

in Figure 2. Initially (time zero), biofilm covered 45.29% ± 14.70% of substrate surface and was mostly composed by living cells (96% ± 0.03%). Biofilm total volume was

Referências

Documentos relacionados