• Nenhum resultado encontrado

[PDF] Top 20 Expression of VEGF-A in intraepithelial and invasive cervical neoplasia

Has 10000 "Expression of VEGF-A in intraepithelial and invasive cervical neoplasia" found on our website. Below are the top 20 most common "Expression of VEGF-A in intraepithelial and invasive cervical neoplasia".

Expression of VEGF-A in intraepithelial and invasive cervical neoplasia

Expression of VEGF-A in intraepithelial and invasive cervical neoplasia

... analysis of premalignant, noninvasive lesions, arising in a variety of organs, has revealed the early tripping of the “angiogenic switch” ...[4,7]. In several types of carcinoma, ... See full document

5

Number of fragments, margin status and thermal artifacts of conized specimens from LLETZ surgery to treat cervical intraepithelial neoplasia

Number of fragments, margin status and thermal artifacts of conized specimens from LLETZ surgery to treat cervical intraepithelial neoplasia

... CONTEXT AND OBJECTIVE: Large loop excision of the transformation zone (LLETZ) is a nontraumatic cut and coagulation method with several advantages, but it induces thermal artifacts in the cut ... See full document

5

Reprogramming energy metabolism and inducing angiogenesis: co-expression of monocarboxylate transporters with VEGF family members in cervical adenocarcinomas

Reprogramming energy metabolism and inducing angiogenesis: co-expression of monocarboxylate transporters with VEGF family members in cervical adenocarcinomas

... for cervical cancer development as well as for anal, head and neck, penile cancers, among other malignancies ...[1]. Cervical cancer is a serious problem for developing countries’ public health ... See full document

11

Risk factors for cervical intraepithelial neoplasia in HIV-infected women on antiretroviral treatment in Cote d'Ivoire, West Africa.

Risk factors for cervical intraepithelial neoplasia in HIV-infected women on antiretroviral treatment in Cote d'Ivoire, West Africa.

... impact of ART on the occurrence of CIN+ in resources-limited settings have been ...Nigeria and South Africa found no association between squamous intraepithelial lesions (SILs) ... See full document

7

HSP27 is Commonly Expressed in Cervical Intraepithelial Lesions of Brazilian Women

HSP27 is Commonly Expressed in Cervical Intraepithelial Lesions of Brazilian Women

... present in cells protecting them from various stresses, such as extreme temperature, anoxia or chemical ...agents. Cervical cancer is the second most prevalent malignancy of ...women. In this ... See full document

4

Role of endoglin and VEGF family expression in colorectal

Role of endoglin and VEGF family expression in colorectal

... up-regulated in tumor angiogenesis [13, 25, 29] ...[29] and, as it is present mainly in new vessels, it is very useful in the assessment of newly formed vessels in malignant ... See full document

9

Chlamydia trachomatis co-infection in HPV positive women brings no additional risk of high-grade cervical intraepithelial neoplasia

Chlamydia trachomatis co-infection in HPV positive women brings no additional risk of high-grade cervical intraepithelial neoplasia

... entry and persistence of multiple high-risk HPV (HR-HPV) types in the cervical ...This in turn could lead to viral integration, inhibition of apoptosis and overexpression ... See full document

5

L1 sequence of a new human papillomavirus type-58 variant associated with cervical intraepithelial neoplasia

L1 sequence of a new human papillomavirus type-58 variant associated with cervical intraepithelial neoplasia

... gene of isolate Bsb-02 was amplified using the DN6/DN7 primer set (DN6-5' GGGGA ATTCATGGTGCTGATTTTATGTTGCACC 3'; DN7-5' CCCAAGGTTTAGTGTAAG TACCACAAC 3') and subsequently cloned into a pGEM T easy vector ... See full document

4

AKT1 loss correlates with episomal HPV16 in vulval intraepithelial neoplasia.

AKT1 loss correlates with episomal HPV16 in vulval intraepithelial neoplasia.

... 16 and 18 whereas extragenital SCC has been linked to the presence of cutaneous beta and gamma–HPV ...mucosal and cutaneous (beta-, mu-, nu- and gamma-) PV types, but there are few ... See full document

7

The differential expression of OCT4 isoforms in cervical carcinoma.

The differential expression of OCT4 isoforms in cervical carcinoma.

... growth and metastasis depend on the development of a neovasculature in and around the tumor ...tumor and its environment [40]. In this study, we found the upregulation of ... See full document

15

Conditional transgenic expression of PIM1 kinase in prostate induces inflammation-dependent neoplasia.

Conditional transgenic expression of PIM1 kinase in prostate induces inflammation-dependent neoplasia.

... malignancy in men in the western ...series of defined states, such as prostate intraepithelial neoplasia (PIN), prostate cancer in situ, invasive cancer and finally ... See full document

13

Sexually Transmitted Infections Detected by Multiplex Real Time PCR in Asymptomatic Women and Association with Cervical Intraepithelial Neoplasia Infecções sexualmente transmissíveis detectadas por PCR multiplex em tempo real em mulheres assintomáticas e

Sexually Transmitted Infections Detected by Multiplex Real Time PCR in Asymptomatic Women and Association with Cervical Intraepithelial Neoplasia Infecções sexualmente transmissíveis detectadas por PCR multiplex em tempo real em mulheres assintomáticas e

... detection of others STIs was performed by M-qPCR with TaqMan (Applied Biosystems, Foster, CA, US) probes using specific assays to detect simultaneously ...quality of the extracted DNA. Positive STI controls ... See full document

7

MicroRNA expression variability in human cervical tissues.

MicroRNA expression variability in human cervical tissues.

... miRNA expression variability among cervical samples may complicate the use of miRNA profiling in clinical ...consistency of cervical cancer miRNA profiles available in the ... See full document

12

Neoplasia intra-epitelial cervical: diagnóstico e tratamento.

Neoplasia intra-epitelial cervical: diagnóstico e tratamento.

... detection of its precursor lesions and human papillomavirus infection, such as cervical cytology and molecular biology, achieved widespread use ...use of these methods in ... See full document

9

Estrogen and progesterone receptors in human papilloma virus-related cervical neoplasia

Estrogen and progesterone receptors in human papilloma virus-related cervical neoplasia

... ER expression in the epithelium was ob- served in only 20% of HPV-positive tumors, as compared to 50% of the normal tissues (P = ...tained in previous studies in which ER ... See full document

6

HPV infection and cervical neoplasia: associated risk factors

HPV infection and cervical neoplasia: associated risk factors

... performed and analyzed according to the criteria defined by the World Health Organization, being classified as normal/ cervicitis, CIN 1, CIN 2, CIN 3, invasive squamous cell carcinoma (SCC) or ... See full document

7

Cervical cancer and HIV/AIDS - Influence of HIV/AIDS on cervical precancerous lesions and invasive cervical cancer in Morogoro region. Tanzania

Cervical cancer and HIV/AIDS - Influence of HIV/AIDS on cervical precancerous lesions and invasive cervical cancer in Morogoro region. Tanzania

... status and infections, for example, malaria, HIV and TB, are ravaging in Morogoro region as well as the whole sub-Saharan Africa and have made many people immuno-compromised ...association ... See full document

64

Prognostic value of DNA and mRNA E6/E7 of human papillomavirus in the evolution of cervical intraepithelial neoplasia grade 2

Prognostic value of DNA and mRNA E6/E7 of human papillomavirus in the evolution of cervical intraepithelial neoplasia grade 2

... participate in the study, and signed the informed con- ...period and a cervical smear and colposcopy were performed every three ...worsening of the suspect image during the ... See full document

8

Role of endoglin and VEGF family expression in colorectal cancer

Role of endoglin and VEGF family expression in colorectal cancer

... up-regulated in tumor angiogenesis [13, 25, 29] ...[29] and, as it is present mainly in new vessels, it is very useful in the assessment of newly formed vessels in malignant ... See full document

9

Non-invasive treatment modalities for Vaginal Intraepithelial Neoplasia (VaIN)

Non-invasive treatment modalities for Vaginal Intraepithelial Neoplasia (VaIN)

... articles and for case reports; for “image of the trimester” a maximum of 3 ...accepted, and this number may be exceeded in corporate studies involving more than two ...One of the ... See full document

37

Show all 10000 documents...