[PDF] Top 20 Method for deoxyribonucleic acid extraction
Has 10000 "Method for deoxyribonucleic acid extraction" found on our website. Below are the top 20 most common "Method for deoxyribonucleic acid extraction".
Method for deoxyribonucleic acid extraction
... ribosomal deoxyribonucleic acid segment that was amplified in Entamoeba histolytica and Entamoeba dispar in distinct reactions using differ- ent direct primers (Eh GTACAAAATGGCCAATTCATTC and Ed ... See full document
5
PHYSICAL EXTRACTION OF PROPIONIC ACID
... the acid may be correlated to some extent with the physico- chemical properties of the solvents, yet no general correlation could be ...of acid to the free energy of ...of extraction and nature of ... See full document
13
MATERIAL AND METHOD Material
... the extraction yields and total content of phenolic compounds ...the extraction yield ranged from ...the extraction method and solvent used. The Soxhlet method showed the highest yield ... See full document
6
J. Braz. Chem. Soc. vol.27 número11
... the extraction of Ag-DTZ chelate by a coacervate made up of decanoic acid reverse micelles prior to the determination by ...proposed method can be used successfully for the extraction and ... See full document
6
Western diet induces endogen oxidative deoxyribonucleic acid damage and infl ammation in Wistar rats
... (ELISA) method, the serum oxidative DNA damage and 8-OHdG levels (DNA/RNA oxidative damage ELISA Kit, Cayman Chemical, and Ann Arbor, United States), and the serum PARP-1, Fas L, Cyt c, suPAR and YKL-40 levels ... See full document
11
J. Braz. Chem. Soc. vol.24 número5
... efficient method based on the integration of pressurized solvent extraction (PSE) with solid phase extraction (SPE) cleanup and gas chromatography system with electron capture detection (GC-ECD) has ... See full document
6
Evaluation of extraction methods for recovery of fatty acids from marine products
... Soxhlet method. For some samples, it was lower than the fatty acid content by DM because of the low extracting ...by Acid hydrolysis and B&D are higher than the total fatty acids by DM in the ... See full document
125
Rev. Nutr. vol.23 número1
... The products analyzed in this study are the most commonly used SPI-based formulas in clinical practice in Brazil. Fifty grams of each formula were homogenized by manual shaking and samples (100mg) were withdrawn for ... See full document
8
Iron extraction from Brazilian smectite by dithionite-citrate-bicarbonate method.
... altering the clay structure in a significant way. Samples were treated with the Dithionite-Citrate- Bicarbonate method (DCB) for 30 and 120 minutes (pH=9.1), and also with citric acid (pH=1.8; time=15min), ... See full document
6
J. Braz. Chem. Soc. vol.27 número1
... squares method, for muscle and kidney and their pure errors and confidence ...the extraction phase and percentage of acetic acid in the extraction phase and their ...acetic acid in the ... See full document
6
Rev. Bras. Hematol. Hemoter. vol.32 número6
... Gerber method is not suitable for lipid extraction from human plasma, while the Rose-Gottlieb method, despite efficient lipid extraction, was not good to assess the fatty acid ...The ... See full document
2
A DEOXYRIBONUCLEIC ACID COMPRESSION ALGORITHM USING AUTO-REGRESSION AND SWARM INTELLIGENCE
... substitutional method, the algorithm is applied on eleven benchmark DNA sequences and compared with other compression algorithms, the results shows that the compression ratio is superb among other ... See full document
9
J. Braz. Chem. Soc. vol.27 número12
... phase extraction method based on MWCNTs coated cellulose acetate membrane was developed for the extraction and preconcentration of REEs, prior to simultaneous ICP OES ...This method is fast, ... See full document
6
J. Braz. Chem. Soc. vol.25 número7
... extraction (USAE) require shorter extraction time, they use low amount of solvents, allow for simultaneous parallel processing of several samples and are automatic but more expensive. The important step in ... See full document
6
A cluster method for finding node sets / sub-networks based on between- node similarity in sets of adjacency nodes: with application in finding sub-networks in tumor pathways
... cluster method for finding node sets / sub-networks according to between-node similarity in sets of adjacency nodes was ...the method is highly ...the method are ... See full document
11
An improved method for genomic DNA extraction from strawberry leaves
... Several extraction methods of genomic DNA for identification and characterization of genetic diversity in different plant species are routinely applied during molecular ...DNA extraction is crucial in order ... See full document
7
Eichhornia crassipes: an advantageous source of shikimic acid
... The content of 1 in each extract was determined from regression equation of the calibration curve and expressed in g shikimic acid/g dry weight plant. The yields were compared using Tukey’s test to verify ... See full document
4
J. Braz. Chem. Soc. vol.27 número7
... formic acid required filtering prior to analysis, it is clear that this process is equivalent to an “extraction”, rather than a complete solubilization or ...formic acid extraction approach ... See full document
7
Sequential extraction results in improved proteome profiling of medicinal plant Pinellia ternata tubers, which contain large amounts of high-abundance proteins.
... first extraction using 10% acetic acid selectively extracted acid-soluble HAPs and the second extraction using the SDS-containing buffer extracted remaining acid-insoluble ... See full document
7
Perspectives in isolation of microRNA from thyroid fine-needle aspiration: reply to the letter Nucleic acid recovery from thyroid fine-needle cytology slides
... nucleic acid from the same thyroid FNA stained slides that had been previously analyzed by a cytopathologist enables an integrated diagnosis, as well as repeated FNAs, reducing the costs with cytopathology and ... See full document
2
temas relacionados