1 Pontifícia Universidade Católica do Rio Grande do Sul
Programa de Pós-Graduação em Medicina e Ciências da Saúde
Área de Concentração: Farmacologia Bioquímica e Molecular
Daniela de Oliveira Carvalho
ANÁLISE DA EXPRESSÃO DOS RECEPTORES PURINÉRGICOS P2X NO
CÂNCER DE BEXIGA
2 Daniela de Oliveira Carvalho
ANÁLISE DA EXPRESSÃO DOS RECEPTORES PURINÉRGICOS P2X NO
CÂNCER DE BEXIGA
Dissertação apresentada como requisito parcial para obtenção do Título de Mestre pelo Programa de Pós- Graduação em Medicina e Ciências da Saúde, Área de Concentração em Farmacologia Bioquímica e Molecular, da Pontifícia Universidade Católica do Rio Grande do Sul.
Orientador: Profª. Dr. Fernanda Bueno Morrone
3 Dedico este trabalho aos meus pais, e não poderia ser
diferente, a vocês que são o meu maior exemplo, que
se doaram por inteiros e renunciaram aos seus sonhos,
4 AGRADECIMENTOS
À minha orientadora, Dra Fernanda Morrone, pela oportunidade, apoio e compreensão.
A Capes pela bolsa de estudos concedida.
À colega de laboratório Marina Petersen Gehring, pela colaboração no desenvolvimento do trabalho e que me ajudou em muitos momentos.
As professoras Ana Maria Battastini e Maria Martha Campos pela colaboração e apoio técnico com o trabalho
As amigas da UFRGS Liliana Rockenbach e Fabrícia Dietrich pela colaboração no trabalho.
A Vanessa Sgnaolin, pela generosidade e disposição em colaborar com o meu trabalho.
Ao Dr. Mauricio Reis Bogo, Talita Carneiro Brandão Pereira e Luiza Kist por me ajudarem no desenvolvimento dos experimentos.
5 A todos os colegas do Laboratório de Farmacologia Aplicada, em especial ao André Avelino dos Santos Junior, à Nathalia Sperotto, à Thais Erig e à Bianca Abreu.
Aos colegas do Laboratório Fleury, em especial a Fátima e Clarice pela amizade e incentivo.
Aos amigos especiais: Manoela, Marcelo, Rossana, Vanessa, Anayara, Carol, Caca, Ju, Ana, Nay que seguiram seus destinos, mas sempre aparecem quando é preciso.
A toda minha família pelo carinho e apoio em especial a minha vó Lourdes.
A minha nova família, pela amizade e carinho, em especial a Lucinha e ao tio Paulo.
Ao meu namorado Fernando, pelo amor, incentivo, paciência e pelos momentos maravilhosos vividos.
À minha irmã e amiga Gabriela, por estar sempre presente e pelo constante apoio.
6 RESUMO
7 cultivo. Para confirmar a relevância dos receptores P2X (1-7) no tumor de bexiga, avaliou-se a expressão em biópsias humanas. Para isso, após aprovação pelo comitê de ética local, amostras de tecidos normais e tumorais de bexiga foram obtidas dos mesmos pacientes, submetidos à ressecção cirúrgica no Hospital São Lucas / PUCRS. O RNA total dos tecidos foi isolado utilizando kit TRIzol . O nível de mRNA foi analisado utilizando análise RT - PCR . Resultados: O PCR em tempo real revelou que a expressão de mRNA de receptores purinérgicos P2X, particularmente P2X4R foi significativamente up- regulada em ambas linhagens RT4 e T24. Dados a partir de biópsias de tumores de bexiga humanos que comparam os resultados de expressão do tecido tumoral em relação ao tecido normal de bexiga, demonstrou que os receptores de P2X6 e P2X7 estão superexpressos em tecidos tumorais. Doze genes relacionados com a inflamação, CCL2, CCR2, TNF-α, MAPK3, IL-1β, IL-6, ADORA1, CD200, CD4, CHRNA4, EDNRA e ITGB2 foram significativamente superexpressos em células T24 derivadas de tumor de grau III quando comparadas com as células RT4 derivadas de tumor de grau I. Nossos resultados indicam que os genes superexpressos de inflamação podem desempenhar um papel importante na regulação do tumor de bexiga urinária. Conclusão: Podemos concluir que purinoreceptores P2X e os genes inflamatórios são diferencialmente distribuídos entre bexiga normal e tumoral, o que pode contribuir para as diferentes características destes diferentes tipos de tumores.
8 ABSTRACT
9 specimens of bladder tumors and normal tissues were obtained from the same patients, who have been undergone surgical resection at the Hospital São Lucas/PUCRS. All samples were collected and rapidly frozen in -80ºC with RNA holder. Tissue specimens were ground and then sonicated in a TRIzol kit. The mRNA level was analyzed using RT-PCR analysis. Real-time PCR revealed that the mRNA expression of P2X purinergic receptors, particulary P2X4R was significantly up-regulated on both T24 and RT4 cell lines. Data from human bladder tumor biopsies comparing to bladder normal tissue, showed that P2X6 and P2X7 receptors appeared to be most often up-regulated on tumor tissues. Twelve inflammation related genes, CCL2, CCR2, TNF-α, MAPK3, IL-1β, IL-6, ADORA1, CD200, CD4, CHRNA4, EDNRA e ITGB2 were significantly up-regulated on the grade III bladder tumor cell line T24 when compared to grade I bladder tumor cell line RT4. Our results indicate that the inflammation genes overexpressed may play an important role in regulating urinary bladder cancer. We can conclude that P2X purinoreceptors and inflammation genes are differentially distributed among normal bladder, low and high tumor bladder, which could contribute to the different characteristics of these different types of cells.
Keywords: bladder cancer, P2X receptors, T24 and RT4 cells, human biopsies,
10 LISTA DE ABREVIATURAS
ADORA1 – Receptor de Adenosina A1
ADP – Adenosina 5’- difosfato
AMP – Adenosina 5’-monofosfato
AMPc – Adenosina 5’-monofosfato cíclico ATP –Adenosina 5’- trifosfato
BCG – Bacilo de Calmette-Guérin CCL2 – Ligante de quimiocina 2 CCR2 – Receptor de quimiocina 2 CD200 – Molécula de CD200 CD4 – Molécula CD4
CHRNA4 – Receptor colinérgico, nicotínico, alfa 4 EDNRA – Receptor de endotelina tipo A
e5’NT – Ecto-5’-nucleotidase IL – Interleucina
IL-1β– Interleucina 1 beta IL-6 – Interleucina 6
MAPK, p38 – Proteína Quinase Ativada por Mitogêno NDPK – Nucleosídeos difosfoquinase
NPP – Nucleotídeo pirofosfatase
NTPDase - Ecto-nucleosídeo trifosfato difosfohidrolase
PI3K – Fosfatidilinositol 3-quinase
PTGS1 – Prostaglandina-endoperoxidase sintase 1
11 P2X - receptor purinérgico ionotrópico
P2Y – receptor purinérrgico metabotrópico
p53 – gene supressor tumoral
RT-PCR – transcriptase reversa – reação em cadeia da polimerase SFB – Soro Fetal Bovino
TNFα– Fator de necrose tumoral alfa UDP – Uridina 5’-difosfato
UTP - Uridina 5’-trifosfato
12 SUMÁRIO
1. INTRODUÇÃO ... 13
1.1. Tumor de Bexiga ... 13
1.2. Sinalização purinérgica ... 18
1.2.1. Receptores P2X ... 20
1.3. Tumores e sistema purinérgico ... 22
2. OBJETIVOS ... 25
2.1. Objetivo Geral ... 25
2.2. Objetivos Específicos ... 25
3. ARTIGO CIENTÍFICO ... 26
4. CONSIDERAÇÕES FINAIS ... 50
5. REFERÊNCIAS ... 54
6. Anexo 1 ... 60
13 1. INTRODUÇÃO
1.1. Tumor de Bexiga
O tumor de bexiga é o segundo tipo mais frequente de tumor maligno do trato geniturinário (Jemal, Murray et al. 2005; Shabbir, Ryten et al. 2008). Ele é o quinto tumor maligno mais comum diagnosticado nos Estados Unidos com uma estimativa de 70.000 novos casos (52.000 em homens e 18.000 em mulheres) e 14.000 mortes ao ano (Costantini and Millard 2011; Tanaka and Sonpavde 2011). A incidência em homens é maior do que em mulheres, e os fatores de risco estão associado à industrialização e à ocupação. De fato, a causa mais comum de tumor de bexiga em todo o mundo é a combinação entre infecção e inflamação, associada ao hábito do tabagismo (Jemal, Murray et al. 2005). Infecções recorrentes no trato urinário, cateterismo, urolitíase e fatores genéticos também estão na lista de causas (Tanaka and Sonpavde 2011).
14 Quanto à determinação clínica da doença, o sintoma mais comum do tumor de bexiga é a hematúria, sendo frequentemente esporádica e indolor. O diagnostico é feito através de citoscopia, citologia urinária e biopsia de lesão vesical (Cummings, Barone et al. 1992; Metts, Metts et al. 2000). A citoscopia e citologia são consideradas padrão ouro para diagnostico do câncer, enquanto a citologia possui uma baixa sensibilidade, mas é adequada por apresentar uma alta especificidade (Konety and Getzenberg 2001).
15 Figura 1. Camadas da bexiga e classificação tumoral. Ilustração das camadas
da bexiga e de tumores de diferentes graus de acordo com a classificação e invasibilidade. ( Reproduzido de http://www.iamaguchi.com/page_15.html)
A classificação utilizada atualmente é TMN (tumor-nodo-metástase) (Quadro 1), onde T corresponde ao tamanho do tumor, de acordo com a invasividade nas diferentes camadas da bexiga; N aos linfonódos comprometidos e M à presença de metástase .
Gordura perivisical Músculo
Peritônio Lâmina
16 Quadro 1. Classificação tumor-nodo-metástase
17 tratado com ressecção transuretral. No entanto, esta abordagem terapêutica demonstra um alto risco de recorrência e progressão, o que constitui uma das principais dificuldades de cura dessa doença (Dozmorov, Kyker et al. 2006; Ma, Feugang et al. 2006; Shabbir, Ryten et al. 2008), uma vez que, os tumores invasivos muitas vezes surgem de neoplasias inicialmente superficiais (Shabbir, Ryten et al. 2008).
Mesmo com muitas melhoras nas estratégias cirúrgicas e quimioterápicas para a doença de alto risco, a sobrevida da doença músculo-invasiva e metastática não apresentou significativa evolução nas últimas décadas, pois não se observam avanços significativos na pesquisa de tumor de bexiga. Assim, se percebe que não foram introduzidos grandes avanços na terapêutica para tratamento da doença desde a introdução da BCG (Bacilo de Calmette-Guérin) na década de 70 e da poliquimioterapia com metotrexate, vimblastina e cisplatina, usada pela primeira vez na década de 80 (Sternberg, Yagoda et al. 1985).
Estudos demonstraram que o uso de agentes antitumorais é efetivo para prevenção da reincidência (Swellam, Miyanaga et al. 2003; Shelley, Wilt et al. 2004; Shabbir, Ryten et al. 2008). O tratamento que tem sido comumente realizado é a administração de BCG após a ressecção transuretral, assim como o uso da quimioterapia adjuvante (Shabbir, Ryten et al. 2008). Contudo, suas eficácias são questionáveis, devido aos efeitos adversos (dor vesical, hematúria, febre) e a progressão do tumor durante a terapia que, ainda, pode ser observada (Ma, Feugang et al. 2006).
18 linhagens de células tumorais em cultura e análise de biópsias humanas. Com relação aos tumores de bexiga, duas linhagens celulares denominadas RT4 e T24 têm sido bastante utilizadas, por permitirem a realização de diferentes comparações, uma vez que a linhagem RT4 possui um padrão menos agressivo, derivada de grau 1 (T1, tumor que invade tecido conectivo subeptelial, segundo a classificação TMN) enquanto que a linhagem T24 apresenta um perfil altamente invasivo, derivada de tumor de grau 3 (T3, tumor que invade tecido perivesical, segundo a classificação TNM) (Stella, Bavaresco et al. 2010; Zhu, Yu et al. 2011; Sgnaolin, Pereira et al. 2013) .
1.2. Sinalização purinérgica
As purinas e pirimidinas extracelulares são moléculas sinalizadoras que apresentam diversos efeitos sobre muitos processos biológicos, incluindo: neurotransmissão, contração de músculo liso, secreção, resposta imunológica, inflamação, agregação plaquetária, dor, modulação da função cardíaca, entre outros (Burnstock 2004). Os eventos induzidos por nucleotídeos extracelulares ocorrem via purinoreceptores e são controlados pela ação de ecto-enzimas, denominadas ectonucleotidases, que estão localizadas na superfície celular, podendo também estar presentes no meio intersticial ou nos fluídos corporais (Zimmermann, 2006).
19 afinidade por nucleosídeos di- e trifosfatados (ATP, ADP, UTP, e UDP). Os receptores P1 são acoplados à proteína G e se subdividem em 4 subtipos, A1,
A2A, A2B, e A3, de acordo com a estrutura molecular, bioquímica e
caracterização farmacológica (Burnstock and Di Virgilio 2013). O ATP promove seus efeitos por interações com diferentes receptores de superfície celular, denominados receptores purinérgicos do tipo P2. Estes receptores são divididos, de acordo com critérios farmacológicos, em dois grupos distintos: os ionotrópicos P2X e os metabotrópicos P2Y (Figura 2).
COO -NH 2 Intracellular ADP NH 2 AMP
Pi Pi
Pi
COO -NH
2
P2X P2Y P1
E-NTPDase
1,2,3 and 8
E-NTPDase
1,2,3 and 8
Extracellular
E5’NT
Figura 2. Sinalização Purinérgica. O ATP é liberado para o meio extracelular
como uma molécula de sinalização e exerce seus efeitos ligando-se aos receptores P2X e P2Y, sendo hidrolisado pelas NTPDases em ADP, que também liga-se aos receptores P2Y. O ADP por sua vez também é hidrolisado pelas NTPDases em AMP, no qual é hidrolisado pela e-5’NT. A adenosina
20 Figura retirada do site http://www.crri.ulaval.ca/en/chercheurs_20/jean_sevigny de autoria do Prof. Dr. Jean Sevigny (2009).
Os receptores metabotrópicos P2Y são acoplados à proteína G e já foram identificados oito membros dessa família (P2Y 1,2,3,4,6,11,12,13 e 14) . Esses receptores podem ativar a fosfolipase C (consequentemente liberando cálcio intracelular) ou, afetar a adenilil ciclase e alterar os níveis de cAMP (Burnstock and Di Virgilio 2013) .
O ATP pode induzir respostas em vários tipos celulares, promovendo a proliferação, a diferenciação e a morte em algumas células de tumor (Burnstock and Knight 2004).
1.2.1. Receptores P2X
Os receptores P2X estão diretamente ligados a canais iônicos, induzindo o influxo de cátions como sódio e cálcio, e, dessa forma, ativando cascatas de sinalização intracelulares Ca2+-dependentes. Existem sete exemplares nessa
família de receptores que já foram clonados: P2X1 até P2X7, sendo que o receptor funcional é formado por três subunidades, possibilitando a formação de receptores homo ou hetero oligômeros (P2X2/3, P2X4/6, P2X1/5, P2X2/6,
P2X4/7). Considerando que muitos destes receptores podem ser expressos na
21 A maioria dos receptores P2X está distribuída distintamente nos neurônios centrais e periféricos. Entre eles a expressão de P2X2 e P2X3, está restrita à subpopulação de neurônios sensoriais. O ATP liberado em virtude da lesão tecidual pode evocar a sensação de dor mediada por purinoreceptores P2X3, particularmente na uretra, bexiga e intestino. O ATP é liberado durante a distensão das células epiteliais da bexiga, da uretra e do intestino, atuando em receptores P2X3 em um plexo nervoso subepitelial para iniciar impulsos que são retransmitidos via cordão espinhal aos centros da dor no cérebro (Rong, Spyer et al. 2002). O reflexo de micturação pode ser iniciado pela contração ou distenção das células detrusoras do músculo liso, ou pela sinalização a partir do urotélio. Tem-se demonstrado que a distensão da bexiga é causada pela liberação de ATP a partir do urotélio, o qual pode ativar receptores P2X3 nos terminais nervosos aferentes suburoteliais para evocar a descarga neural. Muito provavelmente a ativação das fibras aferentes durante a distensão da bexiga envolve não somente ATP, mas outros transmissores inibitórios e estimulatórios. Estes mecanismos podem ser alvo para o desenvolvimento de drogas com potencial ação nas disfunções do sistema urinário (Andersson 2002).
22 de roedores (Zanovello, Bronte et al. 1990), melanoma (White, Ryten et al. 2005), tumor de células escamosas (Greig, Linge et al. 2003), tumor de pulmão (Schafer, Sedehizade et al. 2003) e tumor cervical (Wang, Wang et al. 2004).
As modificações genéticas que levam a perda do controle do ciclo e da morte celular são as principais transformações ocorridas na formação dos tumores. Além da resistência à morte, os tumores ainda caracterizam-se por apresentarem processos multifatoriais que dão o suporte fisiológico para o desenvolvimento tumoral.
1.3. Tumores e sistema purinérgico
O sistema purinérgico pode estar envolvido com o desenvolvimento tumoral em vários tipos de cânceres, entre eles: melanoma, carcinoma epitelial intestinal e gliomas (Morrone, Jacques-Silva et al. 2003; Coutinho-Silva, Stahl et al. 2005; White, Ryten et al. 2005; Gehring, Pereira et al. 2012).
A sinalização purinérgica no controle da função urinária tem sido estudada desde 1972. Os trabalhos mais recentes mostram o potencial terapêutico de compostos purinérgicos na incontinência urinária, dor e câncer (Burnstock 2013).
Nos últimos anos tem sido sugerida a hipótese do envolvimento do P2XR nos processos de crescimento celular e neoplasia (Burnstock 2013). Em relação ao tumor de bexiga, alguns estudos demonstraram a expressão e o papel funcional dos receptores P2X5 e/ou P2Y11 na resposta antineoplásica
23 P2X3 = P2X6 = 0 (O'Reilly, Kosaka et al. 2001). Há também receptores heteromultiméricos tais como: P2X2/3, P2X1/2, P2X1/5, P2X2/6 e P2X4/6 (Burnstock 2007). Examinando a distribuição dos subtipos de receptores P2X no músculo liso da bexiga urinária foi encontrado que o receptor P2X2 é o subtipo purinérgico predominante, com menor expressão de P2X1 seguido por P2X3 e P2X7. Os subtipos P2X4, P2X5 e P2X6 não foram identificados (Birder, Ruan et al. 2004).
24 A eficácia do tratamento do tumor de bexiga é questionável devido à progressão deste tumor durante a terapia, bem como aos efeitos adversos apresentados pelos pacientes (Aldousari and Kassouf 2010).
Além disso, tem sido demonstrada a participação dos receptores P2X na sinalização da dor visceral e a participação de seus subtipos, como o receptor P2X3 nos mecanismos de controle do reflexo de micturação, e do receptor P2X7 que classicamente em outros sistemas está envolvido no importante processo de apoptose (Burnstock 2007).
Os compostos purinérgicos endógenos desempenham um papel chave na resposta à inflamação através de vias de sinalização extracelulares. A inflamação está presente no microambiente da maioria dos tecidos neoplásicos e um aumento dos níveis de mediadores inflamatórios tem sido mostrado na promoção da diferenciação, invasão e angiogênese do tumor (Chen, Lin et al. 2013). No entanto, em certas circunstâncias, a inflamação mediada através de receptores P2 pode tornar-se patológica, e levar a danos nos tecidos (Arulkumaran, Turner et al. 2013). Recentes descobertas em muitas doenças, como no câncer, revelaram que a inflamação tem importante participação nos processos fisiopatológicos por meio da ativação de células inflamatórias ou por desencadear mecanismos de sinalização inflamatórias nas células do tecido (Moilanen 2014).
25 2. OBJETIVOS
2.1. Objetivo Geral
Caracterizar a expressão dos receptores purinérgicos P2X (1-7) em biópsias de câncer de bexiga e linhagens celulares de tumor de bexiga humano, relacionado com o perfil de genes inflamatórios mais expressos nestas amostras.
2.2. Objetivos Específicos
- Avaliar a expressão dos receptores purinérgicos P2X (1-7), em amostras de tecido normal e tumoral de bexiga humano, por meio de PCR em tempo real.
- Avaliar a expressão dos receptores purinérgicos P2X (1-7), por meio de PCR em tempo real, em linhagens celulares RT4 e T24 de tumor de bexiga humano.
- Realizar estudos de expressão de genes relacionados à inflamação nas linhagens celulares RT4 e T24, por meio da técnica de arrayPCR.
26 3. ARTIGO CIENTÍFICO
Titulo: CHARACTERIZATION OF P2X PURINERGIC RECEPTORS AND
INFLAMMATION GENE PROFILE ON HUMAN BLADDER CANCER
Submetido ao Periódico Urology Oncology: Seminars and Original
Investigations
27 Ms. Ref. No.: URO-D-14-00022
Title: CHARACTERIZATION OF P2X PURINERGIC RECEPTORS AND INFLAMMATION GENE PROFILE ON HUMAN BLADDER CANCER Urologic Oncology: Seminars and Original Investigations
Dear Ms. Gehring,
Thank you for submitting your manuscript entitled
"CHARACTERIZATION OF P2X PURINERGIC RECEPTORS AND INFLAMMATION GENE PROFILE ON HUMAN BLADDER CANCER". We have assigned it Number URO-D-14-00022.
Please use this manuscript number in any correspondence with us.
Your manuscript will be reviewed by experts in the field, according to the keywords you have provided. You will hear from us as soon as their reviews are completed (usually approximately 4-6 weeks).
To track the status of your paper, please do the following: 1. Go to this URL: http://ees.elsevier.com/uro/
2. Enter your login details 3. Click [Author Login]
This takes you to the Author Main Menu. 4. Click [Submissions Being Processed]
Thank you for submitting your work to Urologic Oncology: Seminars and Original Investigations.
Kind regards, Esther Schweizer Managing Editor
Urologic Oncology: Seminars and Original Investigations ******************************************
Please note that the editorial process varies considerably from journal to journal. To view a sample editorial process, please click here:
http://ees.elsevier.com/eeshelp/sample_editorial_process.pdf
For further assistance, please visit our customer support site at
28 CHARACTERIZATION OF P2X PURINERGIC RECEPTORS AND
INFLAMMATION GENE PROFILE ON HUMAN BLADDER CANCER
Word count: 2.560
Daniela Oliveira Carvalho, Pharmaceutist; Laboratório de Farmacologia Aplicada, Avenida Ipiranga, 6681, Partenon, 90619-900, Porto Alegre, RS, Brazil. Phone number: 55 51 33204807; Fax number: 55 51 33203512. danielacarvalho_farm@yahoo.com.br
Marina Petersen Gehring, MsC; Laboratório de Farmacologia Aplicada, PUCRS, Avenida Ipiranga, 6681, Partenon, 90619-900, Porto Alegre, RS, Brazil. Phone number: 55 51 33204807; Fax number: 55 51 33203512. marinapgehring@gmail.com
Talita Carneiro Brandão Pereira, MsC; Laboratório de Biologia Genômica e Molecular e INCT-TM, PUCRS, Avenida Ipiranga, 6681, Partenon, 90619-900, Porto Alegre, RS, Brazil. Phone number: 55 51 33534727; Fax number: 55 51 33203568.
talitapereira@gmail.com
Liliana Rockenbach, MsC; Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Rua Ramiro Barcelos, 2600-anexo, Porto Alegre, RS – Brasil. Phone number: 55 51 33085539; Fax number: 55 51 33085535. lilarockk@gmail.com
Luisa Wilges Kist; PhD;Laboratório de Biologia Genômica e Molecular e
29 lwkist@gmail.com
Gustavo Franco Carvalhal4, PhD; Departamento de Cirurgia, PUCRS, Av.
Ipiranga, 6690, Porto Alegre, RS – Brasil. Phone number: 55 51 33203000 (2570).
gustavo.carvalhal@pucrs.br
Ana Maria Oliveira Battastini, PhD; Departamento de Bioquímica, Instituto de Ciências Básicas da Saúde, UFRGS, Rua Ramiro Barcelos, 2600-anexo, Porto Alegre, RS – Brasil. Phone number: 55 51 33085539; Fax number: 55 51 33085535.
abattastini@gmail.com
Maurício Reis Bogo, PhD; Laboratório de Biologia Genômica e Molecular e
INCT-TM, PUCRS, Avenida Ipiranga, 6681, Partenon, 90619-900, Porto Alegre, RS, Brazil. Phone number: 55 51 33534727; Fax number: 55 51 33203568. mbogo@pucrs.br
Corresponding author: Fernanda Bueno Morrone, PhD; Laboratório de
Farmacologia Aplicada, PUCRS, Avenida Ipiranga, 6681, Partenon, 90619-900, Porto Alegre, RS, Brazil. Phone number: 55 51 33204807; Fax number: 55 51 33203512.
30 Abstract
The molecular biology of bladder cancer needs to be better understood in an attempt to find new therapeutic targets. Purinergic signalling is involved in a number of physiological and pathophysiological activities in the urinary tract, including tumor bladder. In the present study we characterized the purinergic receptors P2X (1-7) expression profile on human bladder tumor cell lines and biopsies; and investigated the inflammatory genes that are up-regulated on high-grade human tumor bladder cells compared to low grade tumor bladder cells. Real-time PCR revealed that the mRNA expression of P2X purinergic receptors, particularly P2X4R, was significantly up-regulated on both T24 and RT4 cell lines. Data from human bladder tumor biopsies comparing to bladder normal tissue, showed that P2X6 and P2X7 receptors appeared to be most often up-regulated on tumor tissues. Inflammation related genes (C-C chemokine ligand type 2 (CCL2), C-C chemokine receptor type 2 (CCR2), tumor necrosis factor alpha (TNF-α), mitogen-activated protein kinases 3 (MAPK3), interleukin-1 beta (IL-1β), interleukin-6 (IL-6) and adenosine A1 receptor were significantly up-regulated on the grade III bladder tumor cell line T24 when compared to grade I bladder tumor cell line RT4. We can conclude that P2X purinoreceptors and inflammation genes are differentially distributed among normal bladder, low and high tumor bladder, which could contribute to the different characteristics of these different types of cells. Furthermore, our data indicate the inflammation genes that may play an important role in regulating urinary bladder.
Keywords: bladder cancer, human biopsies, inflammation, P2X receptors, T24
31 INTRODUCTION
Bladder cancer is classified among the five most common malignancies in industrialized countries [1] and remains as a tremendous burden for health systems worldwide [2]. Current preclinical research programs have studied P2X purinergic receptor involvement in bladder dysfunction [3], as purinergic signalling is involved in a number of physiological and pathophysiological activities in the urinary tract, including tumor bladder [4]. Therefore, there is growing interest in the therapeutic potential of purinergic signalling for cancer treatment [3]. Purinergic receptors are widely expressed by mammalian cells and mediate a large array of responses ranging from growth stimulation to apoptosis, from chemotaxis to cell differentiation and from nociception to cytokine release, as well as neurotransmission [5].
P2 purinergic receptors are “danger sensors” and are key players in
inflammation. However, in certain circumstances, inflammation mediated via P2R may become pathological, leading to tissue damage [6]. Recent discoveries in many diseases, as cancer, have revealed inflammation to be a major factor participating in the underlying pathophysiological processes, either through activation of inflammatory cells or through triggering inflammatory mechanisms in cancer [7].
32 MATERIAL AND METHODS
Cell lines and cell culture
Human bladder carcinoma cells, T24 and RT4, were obtained from ATCC. Cells were cultured in RPMI or in DMEM, respectively; with 10% fetal bovine serum at
a temperature of 37°C, 95% of humidity and an atmosphere of 5% CO2.
Human bladder biopsies
Upon approval of the research protocol by the local ethics committee from PUCRS (nº06/02970) Porto Alegre, Brazil, specimens of bladder tumors and normal tissues were obtained from the same patients, who have been undergone surgical resection at the São Lucas Hospital (HSL), Porto Alegre, Brazil. All samples were collected and rapidly frozen in –80ºC with RNA holder. The study included tissues obtained from 8 patients. In each case, there were included cross sections of the cancer tissue and an adjacent histologically normal tissue. The histological diagnoses presented were made by the Pathology Department of HSL.
Analysis of PXR mRNA expression on human bladder cancer cell lines
and biopsies
Total RNA from bladder tumors/control tissues, or T24 and RT4 were isolated with Trizol (Invitrogen). The cDNA were synthesized with ImProm-II™ Reverse
Transcription System (Promega) from 1 μg total RNA. All quantitative PCR were
33 7500 Fast Real-Time System Sequence Detection Software v.2.0.5 (Applied Biosystems). The efficiency per sample was calculated using LinRegPCR 11.0 Software (http://LinRegPCR.nl). Relative RNA expression levels were determined using the 2-∆∆CT method. The stability of the reference genes 18S and GAPDH (M-value) were analyzed by GeNorm 3.5 Software (http://medgen.ugent.be/genorm/).
PCR Array
Total RNA from cell lines was isolated with RNeasy® Mini Kit (Qiagen®) and the DNase digestion step was made with the On-column DNase digestion step (Qiagen®). One microgram of RNA was reverse-transcribed into cDNA by RT2 First Strand (Qiagen®) in a final volume of 20 μL. The RT² Profiler™ PCR Array
Human Pain: Neuropathic & Inflammatory PCR Array (PAHS-162Z) was used to analyze mRNA levels of 84 genes. From these 84 genes, we analyzed 40 of them that are described as related to inflammation. Data were analyzed on a 7500 Fast Real-Time System Sequence Detection Software v.2.0.5 (Applied Biosystems). All genes represented by the PCR array showed a single peak on the melting curve characteristic to the specific products.
Statistical analysis
34 Qiagen®. Changes in gene expression were calculated using the 2^-ΔCt
method.
RESULTS
P2X purinergic receptors expression profile on human tumor bladder
biopsies
We analyzed the purinergic receptor expression on eight human bladder tumor biopsies (5 low grade urothelial carcinoma and 3 high grade urothelial carcinoma). Our sample comprised 7 men and 1 woman and the average age was 70.9 ± 5.6. The results were expressed as fold-increase in mRNA
35 P2X purinergic receptors expression profile on human tumor bladder cell
lines
We also analyzed the P2XR expression on two different grade tumor bladder cell lines – RT4 (grade I) and T24 (grade III). Our results showed that both RT4 and T24 cell lines, although being from different grade tumor, expressed the same P2XR profile, in the order of: P2X4 >> P2X5 > P2X6 = P2X1 > P2X2 = P2X3 = P2X7 = 0. The P2X4 receptor was significantly up-regulated than the other receptors expressed on both, T24 and RT4 cell lines. On RT4 cell line, P2X5 receptor was also significantly more expressed than P2X1 and P2X6 receptors (Figure 1).
Different grades of tumor bladder cell lines express different inflammation
gene pattern
36
TNF-α, MAPK3, IL-1β, IL-6, A1R, CD200, CD4, CHRNA4, EDNRA and ITGB2,
were significantly up-regulated T24 when compared RT4 (Figure 2C).
Discussion
The current study demonstrates, for the first time, the P2XR expression profile on human bladder tumor cell lines and biopsies. Furthermore, it was shown some important data regarding the up-regulation of some inflammatory genes in high grade tumor bladder cells.
Our study showed that P2X6 and P2X7 receptor expression were generally increased on human tumor biopsies in comparison to normal tissues, but it was independent of cancer stage. It is important to mention that these results were correlated by fold-increase in mRNA expression comparing tumor bladder tissue to normal bladder tissue. The other receptors not shown in Table 2 were expressed equally on both tissues without a significant difference. It is known that P2X6R is associated with the thin basement membrane beneath the urothelium [8]. This receptor does not form homomultimers, but rather heteromultimers with either P2X2 or P2X4 receptors [9], what could explain its high expression in patients biopsies. P2X4R and P2X6R are associated with cell adhesion molecule VE-cadherin [10]. Patients with strong E-cadherin expression had a mean disease-free survival smaller than patients with moderate expression and its related to tumor recurrence [11]. A study showed that TNF-α inhibited the downregulation of P2X6 mRNA associated to prolonged agonist exposure [12].
37 proliferative role has also been suggested. Nuclear staining of P2X7R was seen in the urothelium [8]. P2X7R transfected HEK293 cells exhibited enhanced tumorigenesis when inoculated into immune deficient BALB/c mice; moreover, P2X7R expression has been reported to be up-regulated in malignant tumor cells [6].
We have shown that P2X receptors present a different pattern of expression on human tumor bladder cells, RT4 and T24. An interesting study showed that in adult normal bladders P2X1 was by far the predominant purinergic receptor at the messenger RNA level. The remaining purinergic receptors were consistently present in the order P2X1 ≫ P2X4 > P2X7 ≫ P2X5 > P2X2 ≫ P2X3 = P2X6 = 0 [13]. So far, six functional P2XR heteromeric receptors have been characterized: P2X1/2R, P2X1/4R, P2X1/5R, P2X2/3R, P2X2/6R, and P2X4/6R [14]. A study showed that P2XR heteromers composition is plastic and dependent on the relative subunit expression levels. It suggested that this property of receptor assembly might introduce an additional layer of subtlety into P2XR signaling [15].
38 that IL-1β, IL-6 and TNF-α are up-regulated on grade III tumor bladder cells (T24) when compared to grade I tumor bladder cells (RT4). In an interesting way, recent data from our group have revealed also evidence of the involvement of the purinergic system in bladder tumorigenesis, related to ecto-5'-NT/CD73, the enzyme responsible for AMP hydrolysis [17]. As we showed here, IL-1β and TNF-α are up-regulated on T24 cells and these cytokines have been shown to enhance CD73 activity [18].
Regarding the other receptors studied, P2X5R is present in cells in the skin, gut, bladder, thymus, skeletal muscle and the spinal cord [19] and shows to be high expressed on urothelial membranes [8]. P2X5R has been correlated with a potential differentiating role [19] which may explain the high expression found in tumor bladder cell lines that suffer many differentiations. P2X1R is associated with the smooth muscle membranes in the bladder detrusor muscle [8] and it is markedly increased in obstructed bladder [20]. Non-membrane associated smooth muscle reactivity was seen with P2X2> P2X5 = P2X6 [8]. We did not find P2X3R expression in the samples studied. Immunoreactivity of this receptor is seen within nerve bundles in detrusor muscle only [8]. P2X3R knockout mice have defects in afferent sensation, impaired ability to sense bladder filling and bladder distension cause ATP release in the urothelium, this suggests that ATP forms the link between sensory stimulus (in this case mechanical) and sensory nerve activation [21].
39 P2X7R, and also improves the systemic symptoms associated with advanced malignancy [23]. These results are in agreement with our data that which demonstrated that these two receptors were up-regulated on tumor bladder cell lines and tumor bladder biopsies, respectively.
We have shown that some inflammatory genes are up-regulated on grade III tumor bladder cells (T24) when compared to grade I tumor bladder cells (RT4). TNFα plays a central role in tumor progression. Constitutive
expression of the TNFα from tumor microenvironment is a characteristic of many malignant tumors and its presence is often associated with poor prognosis [24]. Consistent with our findings, Ho et al. (2008) demonstrated that TNF- α can induce CCL2 expression via the activation of the intracellular MAPK
signaling pathway, which may contribute to macrophage and lymphocyte infiltration [25]. Pursuant to, another study with human and murine xenografts suggested that macrophages and the CCL2/CCR2 axis were necessary for the protein versican (VCAN) to exert its metastasis-promoting role. Several reports have implicated CCL2 chemokine in a myriad of activities that affect cancer progression and metastasis. Tumor-derived CCL2 has been involved in the recruitment of CCR2+ myeloid cells as well as in their differentiation into an inflammatory phenotype that fosters extravasation, seeding and persistent growth of tumor cells [26].
40 mechanism for pain hypersensitivity [27]. There is an increasing concern that inflammatory microenvironments caused by infiltrating leukocytes can facilitate cancer development. These leukocytes secrete proinflammatory cytokines such as IL-1, IL-6, TNFα, TGFβ, FGF, EGF and HGF21, as well as chemokines such as CCL2 and CXCL8 [24]. As we can observe, grade III tumor cell line T24 seems to resemble inflammatory cells, since we have shown that many of the pro-inflammatory cytokines, such as IL-1, IL-6, TNFα, and CCL2, secreted by leukocytes are up-regulated in these high grade tumor, probably to facilitate its own growth.
Studies have suggested that IL-6 is associated with a number of biological functions in bladder cancer, including cell proliferation, cell transformation, inflammation, and detrusor smooth muscle contractility [28]. Additionally, IL-6 was overexpressed in the bladder cancer specimens compared with non-malignant tissues at both mRNA and protein levels. Positive staining of IL-6 was significantly correlated with higher clinical stage, higher recurrence rate after curative treatment, and reduced survival rate [29]. Finally, recent studies suggested that elevated levels of IL-6 in the serum and urine of patients suffering from bladder cancer correlated with tumor size and grade [30]. These data corroborates with our data where IL-6 was overexpressed on the high grade T24 cell line comparing to low grade RT4 cells. Here we also found the A1R up-regulated on high grade tumor bladder cells (T24). Accordingly, Yu et al. also detected the presence of transcripts for A1R in T24 cell line [31].
41 therefore, in this study it appeared up-regulated in the more aggressive T24 lineage [30].
42 Acknowledgements
43 References
1. Konstantakou, E.G., et al., Human bladder cancer cells undergo
cisplatin-induced apoptosis that is associated with p53-dependent and p53-independent responses. Int J Oncol, 2009. 35(2): p. 401-16.
2. Aldousari, S. and W. Kassouf, Update on the management of non-muscle
invasive bladder cancer. Can Urol Assoc J, 2010. 4(1): p. 56-64.
3. North, R.A. and M.F. Jarvis, P2X receptors as drug targets. Mol Pharmacol, 2013. 83(4): p. 759-69.
4. Burnstock, G., Purinergic signalling in the urinary tract in health and disease. Purinergic Signal, 2013.
5. Burnstock, G. and F. Di Virgilio, Purinergic signalling and cancer. Purinergic Signal, 2013.
6. Arulkumaran, N., et al., Purinergic signaling in inflammatory renal disease. Front Physiol, 2013. 4: p. 194.
7. Moilanen, E., Two faces of inflammation: an immunopharmacological view. Basic Clin Pharmacol Toxicol, 2014. 114(1): p. 2-6.
8. Lee, H.Y., M. Bardini, and G. Burnstock, Distribution of P2X receptors in the
urinary bladder and the ureter of the rat. J Urol, 2000. 163(6): p. 2002-7.
9. Yu, Q., et al., Expression of P2X6 receptors in the enteric nervous system of the
rat gastrointestinal tract. Histochem Cell Biol, 2010. 133(2): p. 177-88.
10. Glass, R., et al., P2X4 and P2X6 receptors associate with VE-cadherin in human
endothelial cells. Cell Mol Life Sci, 2002. 59(5): p. 870-81.
11. Reis, S.T., et al., Immune expression of E-cadherin and alpha, beta and
gamma-Catenin adhesion molecules and prognosis for upper urinary tract urothelial carcinomas. Int Braz J Urol, 2012. 38(4): p. 466-73.
12. Banfi, C., et al., P2 receptors in human heart: upregulation of P2X6 in patients
undergoing heart transplantation, interaction with TNFalpha and potential role in myocardial cell death. J Mol Cell Cardiol, 2005. 39(6): p. 929-39.
13. O'Reilly, B.A., et al., A quantitative analysis of purinoceptor expression in
human fetal and adult bladders. J Urol, 2001. 165(5): p. 1730-4.
14. Coddou, C., et al., Activation and regulation of purinergic P2X receptor
channels. Pharmacol Rev, 2011. 63(3): p. 641-83.
15. Barrera, N.P., et al., The stoichiometry of P2X2/6 receptor heteromers depends
on relative subunit expression levels. Biophys J, 2007. 93(2): p. 505-12.
16. Li, F., et al., Inhibition of P2X4 Suppresses Joint Inflammation and Damage in
Collagen-Induced Arthritis. Inflammation, 2013.
17. Rockenbach, L., et al., Alterations in the extracellular catabolism of nucleotides
are involved in the antiproliferative effect of quercetin in human bladder cancer T24 cells. Urol Oncol, 2013. 31(7): p. 1204-11.
18. Stagg, J. and M.J. Smyth, Extracellular adenosine triphosphate and adenosine
in cancer. Oncogene, 2010. 29(39): p. 5346-58.
19. White, N. and G. Burnstock, P2 receptors and cancer. Trends Pharmacol Sci, 2006. 27(4): p. 211-7.
20. Jacobson, K.A. and J. Linden, Pharmacology of purine and pyrimidine
receptors. Preface. Adv Pharmacol, 2011. 61: p. xv-xvi.
21. Khakh, B.S. and R.A. North, P2X receptors as cell-surface ATP sensors in
health and disease. Nature, 2006. 442(7102): p. 527-32.
22. Burnstock, G., Discovery of purinergic signalling, the initial resistance and
44
23. Burnstock, G., Purinergic signalling in the lower urinary tract. Acta Physiol (Oxf), 2013. 207(1): p. 40-52.
24. Mikirova, N., et al., Effect of high-dose intravenous vitamin C on inflammation
in cancer patients. J Transl Med, 2012. 10: p. 189.
25. Ho, A.W., C.K. Wong, and C.W. Lam, Tumor necrosis factor-alpha
up-regulates the expression of CCL2 and adhesion molecules of human proximal tubular epithelial cells through MAPK signaling pathways. Immunobiology,
2008. 213(7): p. 533-44.
26. Said, N. and D. Theodorescu, RhoGDI2 suppresses bladder cancer metastasis
via reduction of inflammation in the tumor microenvironment.
Oncoimmunology, 2012. 1(7): p. 1175-1177.
27. Toyomitsu, E., et al., CCL2 promotes P2X4 receptor trafficking to the cell
surface of microglia. Purinergic Signal, 2012. 8(2): p. 301-10.
28. Tsui, K.H., et al., Mechanisms by which interleukin-6 attenuates cell invasion
and tumorigenesis in human bladder carcinoma cells. Biomed Res Int, 2013.
2013: p. 791212.
29. Chen, M.F., et al., IL-6 expression regulates tumorigenicity and correlates with
prognosis in bladder cancer. PLoS One, 2013. 8(4): p. e61901.
30. Koul, H.K., M. Pal, and S. Koul, Role of p38 MAP Kinase Signal Transduction
in Solid Tumors. Genes Cancer, 2013. 4(9-10): p. 342-359.
31. Phelps, P.T., J.C. Anthes, and C.C. Correll, Characterization of adenosine
receptors in the human bladder carcinoma T24 cell line. Eur J Pharmacol, 2006.
536(1-2): p. 28-37.
45 Table 1. PCR primer design and PCR product
Bp – base pairs; F – forward; R – reverse.
Genes Sequences (5´–3´) PCR product (bp) GenBank Accession number
GAPDH F TGCACCACCAACTGCTTA
177 NM_002046
R GGATGCAGGGATGATGTTC
18S F GTAACCCGTTGAACCCCATT
151 NR_003286
R CCATCCAATCGGTAGTAGCG
P2X1R F GCGTAATAAGAAGGTGGGCGTTA
164 NM_002558
R GCCGCTCGAGGTCTGGTA
P2X2R F CAGGTTTGCCAAATACTACAAGATCA
202 NM_170682
R AACTTCCCGGCCTGTCCAT
P2X3R F TCTTCACCTATGAGACCACCAAGTC
153 NM_002559
R GATCAGAAGCTGAACTACTCGGTTGATG
P2X4R F CGCAGGACACGGTTTCCA
201 NM_002560
R GCAGTCCCAGTTGACCTGGAT
P2X5R F CGCTGGGGAAGCGGTTA
220 NM_002561
R GCACCAGGCAAAGATCTCACA
P2X6R F CACTGCCGCTATGAACCACAA
205 NM_005446
R CGAAGGTCCCTCCAGCCTT
P2X7R F AAGCTGTACCAGCGGAAAGA
202 NM_002562
46
Table 2. Fold-increase in mRNA expression of P2X (1-7) receptors on human bladder cancer tissues comparing to bladder normal tissue
aTumor classification based on Word Health Organization (WHO)
Case Diagnosis Age Histological gradea Fold-increase in receptor mRNA expression
P2X1 P2X2 P2X3 P2X4 P2X5 P2X6 P2X7
1.
Transitional cell carcinoma grade II
of WHO, with invasion of the lamina propria
58 pT1 0.20 - - - - 2.67 6.31
2.
Transitional cell carcinoma grade II
of WHO, with invasion of the lamina propria
66 pT1 - - - 1.36 0.08
3.
Transitional cell carcinoma grade II
of WHO, with invasion of the lamina propria
76 pT1 0.01 1.11 - - - 1.25 13.61
4.
Transitional cell carcinoma grade II
of WHO, with invasion of the lamina propria
85 pT1 - 0.99 - - 3.88 0.60 0.27
5.
Transitional cell carcinoma grade II
of WHO, with invasion of the lamina propria
82 pT1 - - - 12.63 0.11
6.
Transitional cell carcinoma grade II
of WHO, with invasion of smooth muscle of the lamina propria
76 pT2 59.92 - - - - 0.55 -
7.
Transitional cell carcinoma grade II
of WHO, with invasion of smooth muscle of the lamina propria
57 pT2 - - - 1.10 0.44
8.
Transitional cell carcinoma grade II
of WHO, with invasion of smooth muscle of the lamina propria
47 Legends to the figures
Figure 1. Relative gene expression profile of P2XR on human tumor bladder cell lines RT4 and T24. Overall results from N=4 independent experiments. Each column represents the mean ± SEM. *** p < 0.001 and ** p < 0.01, as determined by ANOVA with Tukey's post-hoc test
49 Figure 2
A)
B)
50 4. CONSIDERAÇÕES FINAIS
O sistema purinérgico pode estar envolvido com o desenvolvimento tumoral em vários tipos de cânceres. Diferentes receptores purinérgicos do tipo P2, estão envolvidos na inibição do crescimento, sendo esta resposta observada em diversos tipos celulares tumorais (Burnstock and Di Virgilio 2013) . A ação antitumoral está, também, relacionada à inibição da proliferação celular, à promoção da diferenciação e morte celular, ou uma combinação desses três processos (Shabbir and Burnstock 2009).
Dados da literatura revelam que os compostos purinérgicos endógenos desempenham um papel chave na resposta à inflamação através de vias de sinalização extracelulares. Descobertas recentes em muitas doenças, como no câncer, revelaram que a inflamação tem participação importante nos processos fisiopatológicos por meio da ativação de células inflamatórias, ou por desencadear mecanismos de sinalização inflamatória nas células do tecido afetado (Moilanen 2014).
51 Os resultados obtidos demonstraram que a expressão dos receptores P2X6 e P2X7 geralmente está aumentada em todas as biópisias tumorais de bexiga humanas comparandos com as biópisias de tecido normal, mas independente do estágio do tumor. Por outro lado, não houve diferença significativa na expressão dos receptores P2X3 e P2X4 quando comparado com tecido de bexiga normal. Da mesma maneira, quando avaliada a expressão de linhagens celulares derivadas de tumor de bexiga, a linhagem T24 (derivada de tumor mais invasivo) em comparação a RT4 (derivada de tumor menos invasivo) mostrou um aumento visível na expressão do receptor P2X6. No entanto, as linhagens não apresentaram expressão do receptor P2X7 na análise por rtPCR. Diante do presente resultado, aprofundamos o estudo e mostramos, através de técnica de array PCR, a expressão do receptor P2X7 nas linhagens humanas T24 e RT4.
52 pensamos que seria importante investigar os principais genes inflamatórios expressos nos tumores de bexiga.
De forma inovadora, o presente trabalho avaliou alguns genes mais importantes relacionados com a resposta inflamatória que são expressos em células T24 (mais invasiva) quando comparado com células RT4 (menos invasiva) . Os principais genes inflamatórios superexpressos foram: CCL2, CCR2, TNF-α, MAPK3, IL-1β, IL-6, A1R, CD200, CD4, CHRNA4, EDNRA e ITGB2. E de maneira análoga sete genes, ALOX5, CCK, DBH, FAAH, ITGAM, TLR2 apresentaram a sua expressão diminuída em relação à linhagem menos invasiva (grau I). Outros genes também foram avaliados neste trabalho, porém, não houve diferença de expressão entre as linhagens estudas.
Como se pode observar nos dados obtidos neste estudo, a linhagem celular de bexiga humano T24 (grau III) expressa uma maior quantidade de genes relacionados a fatores pró-inflamatórios, e a expressão destes genes pode estar associada ao grau de malignidade tumoral (Phelps, Anthes et al. 2006). A identificação de um conjunto comum de genes inflamatórios expressos em diferentes graus de malignidade no tumor de bexiga, fornece informações valiosas sobre possível utilidade clínica para identificar alvos terapêuticos para o tumor de bexiga.
Alguns destes genes, como as MAPK, relacionadas à transdução de sinal, têm um papel importante na manutenção do microambiente do tumor, promovendo o crescimento tumoral (Ho, Wong et al. 2008). A citocina TNFα
53 microambientes inflamatórios e facilitam o desenvolvimento tumoral (Mikirova, Casciari et al. 2012).
Este estudo demonstra, pela primeira vez, o perfil de expressão dos receptores P2X em linhagens tumorais e biópsias de pacientes com câncer de bexiga. Estes receptores podem afetar tanto a malignidade quanto a eficácia terapêutica no tumor de bexiga. Além disso, nossos dados indicam que os genes inflamatórios expressos podem desempenhar um papel importante na regulação do grau de malignidade de tumores na bexiga urinária. Porém, mais estudos são necessários a fim de compreender a relação existente entre os receptores purinérgicos P2X e os genes de perfil inflamatório, bem como os mecanismos envolvidos na sua ativação.
Podemos concluir que os purinoreceptores P2X e os genes inflamatórios estão diferencialmente distribuídos entre bexiga normal e tumoral, o que pode contribuir para as características de malignidade destes tipos celulares.
54 5. REFERÊNCIAS
Aldousari, S. and W. Kassouf (2010). "Update on the management of non-muscle invasive bladder cancer." Can Urol Assoc J 4(1): 56-64.
Andersson, K. E. (2002). "Overactive bladder--pharmacological aspects." Scand J Urol Nephrol Suppl(210): 72-81.
Arulkumaran, N., C. M. Turner, et al. (2013). "Purinergic signaling in inflammatory renal disease." Front Physiol 4: 194.
Babjuk, M., W. Oosterlinck, et al. (2008). "EAU guidelines on non-muscle-invasive urothelial carcinoma of the bladder." Eur Urol 54(2): 303-314. Birder, L. A., H. Z. Ruan, et al. (2004). "Alterations in P2X and P2Y purinergic
receptor expression in urinary bladder from normal cats and cats with interstitial cystitis." Am J Physiol Renal Physiol 287(5): F1084-1091. Burnstock, G. (2004). "Introduction: P2 receptors." Curr Top Med Chem 4(8):
793-803.
Burnstock, G. (2007). "Purine and pyrimidine receptors." Cell Mol Life Sci 64(12): 1471-1483.
Burnstock, G. (2013). "Introduction and perspective, historical note." Front Cell Neurosci 7: 227.
Burnstock, G. (2013). "Purinergic signalling in the urinary tract in health and disease." Purinergic Signal.
Burnstock, G. and F. Di Virgilio (2013). "Purinergic signalling and cancer." Purinergic Signal.
55 Chen, M. F., P. Y. Lin, et al. (2013). "IL-6 expression regulates tumorigenicity and correlates with prognosis in bladder cancer." PLoS One 8(4): e61901.
Costantini, C. and F. Millard (2011). "Update on chemotherapy in the treatment of urothelial carcinoma." ScientificWorldJournal 11: 1981-1994.
Coutinho-Silva, R., L. Stahl, et al. (2005). "P2X and P2Y purinergic receptors on human intestinal epithelial carcinoma cells: effects of extracellular nucleotides on apoptosis and cell proliferation." Am J Physiol Gastrointest Liver Physiol 288(5): G1024-1035.
Cummings, K. B., J. G. Barone, et al. (1992). "Diagnosis and staging of bladder cancer." Urol Clin North Am 19(3): 455-465.
Dozmorov, M. G., K. D. Kyker, et al. (2006). "Analysis of the interaction of extracellular matrix and phenotype of bladder cancer cells." BMC Cancer 6: 12.
Eble JN, Sauter G, Epstein JI, Sesterhenn IA, editors. (2004) Pathology and Genetics of Tumours of the Urinary System and Male Genital Organs. In: Kleihues P, Sobin LH editors. World Health Organization Classification of Tumours. IARCPress. pp. 89-157. Available http://www.iarc.fr/en/publications/pdfs online/pat-gen/bb7/bb7-chap2.pdf. Accessed 10 September 2013
56 Greig, A. V., C. Linge, et al. (2003). "Expression of purinergic receptors in
non-melanoma skin cancers and their functional roles in A431 cells." J Invest Dermatol 121(2): 315-327.
Ho, A. W., C. K. Wong, et al. (2008). "Tumor necrosis factor-alpha up-regulates the expression of CCL2 and adhesion molecules of human proximal tubular epithelial cells through MAPK signaling pathways." Immunobiology 213(7): 533-544.
Jacobson, K. A. and J. Linden (2011). "Pharmacology of purine and pyrimidine receptors. Preface." Adv Pharmacol 61: xv-xvi.
Jemal, A., T. Murray, et al. (2005). "Cancer statistics, 2005." CA Cancer J Clin 55(1): 10-30.
Konety, B. R. and R. H. Getzenberg (2001). "Urine based markers of urological malignancy." J Urol 165(2): 600-611.
Ma, L., J. M. Feugang, et al. (2006). "Growth inhibitory effects of quercetin on bladder cancer cell." Front Biosci 11: 2275-2285.
Martins, J. P., R. B. Silva, et al. (2012). "The role of P2X7 purinergic receptors in inflammatory and nociceptive changes accompanying cyclophosphamide-induced haemorrhagic cystitis in mice." Br J Pharmacol 165(1): 183-196.
Metts, M. C., J. C. Metts, et al. (2000). "Bladder cancer: a review of diagnosis and management." J Natl Med Assoc 92(6): 285-294.
Mikirova, N., J. Casciari, et al. (2012). "Effect of high-dose intravenous vitamin C on inflammation in cancer patients." J Transl Med 10: 189.
57 Morrone, F. B., M. C. Jacques-Silva, et al. (2003). "Extracellular nucleotides and nucleosides induce proliferation and increase nucleoside transport in human glioma cell lines." J Neurooncol 64(3): 211-218.
O'Reilly, B. A., A. H. Kosaka, et al. (2001). "A quantitative analysis of purinoceptor expression in human fetal and adult bladders." J Urol 165(5): 1730-1734.
Phelps, P. T., J. C. Anthes, et al. (2006). "Characterization of adenosine receptors in the human bladder carcinoma T24 cell line." Eur J Pharmacol 536(1-2): 28-37.
Pizzo, P., M. Murgia, et al. (1992). "Role of P2z purinergic receptors in ATP-mediated killing of tumor necrosis factor (TNF)-sensitive and TNF-resistant L929 fibroblasts." J Immunol 149(10): 3372-3378.
Porter, M. P., M. C. Kerrigan, et al. (2011). "Patterns of use of systemic chemotherapy for Medicare beneficiaries with urothelial bladder cancer." Urol Oncol 29(3): 252-258.
Przybylo, M., A. Litynska, et al. (2005). "Different adhesion and migration properties of human HCV29 non-malignant urothelial and T24 bladder cancer cells: role of glycosylation." Biochimie 87(2): 133-142.
Ralevic, V. and G. Burnstock (1998). "Receptors for purines and pyrimidines." Pharmacol Rev 50(3): 413-492.
Ries LAG, Krapcho M, Mariotto AB, Miller BA, Feuer EJ, Clegg L, et al..SEER Cancer Statistics Review; 1975-2010; 2013
58 quercetin in human bladder cancer T24 cells." Urol Oncol 31(7): 1204-1211.
Rong, W., K. M. Spyer, et al. (2002). "Activation and sensitisation of low and high threshold afferent fibres mediated by P2X receptors in the mouse urinary bladder." J Physiol 541(Pt 2): 591-600.
Said, N. and D. Theodorescu (2012). "RhoGDI2 suppresses bladder cancer metastasis via reduction of inflammation in the tumor microenvironment." Oncoimmunology 1(7): 1175-1177.
Schafer, R., F. Sedehizade, et al. (2003). "ATP- and UTP-activated P2Y receptors differently regulate proliferation of human lung epithelial tumor cells." Am J Physiol Lung Cell Mol Physiol 285(2): L376-385.
Sgnaolin, V., T. C. Pereira, et al. (2013). "Functional and molecular characterization of kinin B1 and B 2 receptors in human bladder cancer: implication of the PI3Kgamma pathway." Invest New Drugs 31(4): 812-822.
Shabbir, M. and G. Burnstock (2009). "Purinergic receptor-mediated effects of adenosine 5'-triphosphate in urological malignant diseases." Int J Urol 16(2): 143-150.
Shabbir, M., M. Ryten, et al. (2008). "Purinergic receptor-mediated effects of ATP in high-grade bladder cancer." BJU Int 101(1): 106-112.
59 Stella, J., L. Bavaresco, et al. (2010). "Differential ectonucleotidase expression
in human bladder cancer cell lines." Urol Oncol 28(3): 260-267.
Sternberg, C. N., A. Yagoda, et al. (1985). "Preliminary results of M-VAC (methotrexate, vinblastine, doxorubicin and cisplatin) for transitional cell carcinoma of the urothelium." J Urol 133(3): 403-407.
Swellam, T., N. Miyanaga, et al. (2003). "Antineoplastic activity of honey in an experimental bladder cancer implantation model: in vivo and in vitro studies." Int J Urol 10(4): 213-219.
Tanaka, M. F. and G. Sonpavde (2011). "Diagnosis and management of urothelial carcinoma of the bladder." Postgrad Med 123(3): 43-55.
Wang, Q., L. Wang, et al. (2004). "P2X7 receptor-mediated apoptosis of human cervical epithelial cells." Am J Physiol Cell Physiol 287(5): C1349-1358. Weir, H. K., M. J. Thun, et al. (2003). "Annual report to the nation on the status
of cancer, 1975-2000, featuring the uses of surveillance data for cancer prevention and control." J Natl Cancer Inst 95(17): 1276-1299.
White, N., M. Ryten, et al. (2005). "P2Y purinergic receptors regulate the growth of human melanomas." Cancer Lett 224(1): 81-91.
Zanovello, P., V. Bronte, et al. (1990). "Responses of mouse lymphocytes to extracellular ATP. II. Extracellular ATP causes cell type-dependent lysis and DNA fragmentation." J Immunol 145(5): 1545-1550.
