Mapping the inhibitory
determinants within
the cytoplasmic tail of
CD6
Ana Paula Teixeira da Silva
Mestrado em Biologia Celular e Molecular
Departamento de Biologia2013
Mafalda Pinto, PhD, Instituto de Biologia Molecular e Celular (IBMC) Alexandre Carmo, PhD, Instituto de Biologia Molecular e Celular (IBMC)
Todas as correções determinadas
pelo júri, e só essas, foram efetuadas.
O Presidente do Júri,
Porto,
Faculdade de Ciências da Universidade do Porto
Mestrado em Biologia Celular e Molecular
Ana Paula Teixeira da Silva
Dissertação submetida à Faculdade de Ciências UP como requisito parcial para obtenção do grau de Mestre em Biologia Celular e Molecular.
FCUP Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
IV
I. Agradecimentos
Em primeiro lugar, gostaria de agradecer ao Prof. José Pissarra e ao corpo docente do Mestrado de Biologia Celular e Molecular da Faculdade de Ciências da Universidade do Porto pelo apoio e conselhos dados ao longo do mestrado.
Ao Prof. Doutor Alexandre Carmo, agradeço a oportunidade de trabalhar em Imunologia no grupo de Cell Activation and Gene Expression do Instituto de Biologia Molecular e Celular, ao longo do meu mestrado. Obrigada também pelos ensinamentos científicos que partilhou comigo ao longo do tempo e pela atitude crítica. À Doutora Mafalda Pinto, pela dedicação constante e por toda a ajuda proporcionada diariamente. Obrigada também pelos conhecimentos científicos que me transmitiu. A todos os membros do grupo Cell Activation and Gene Expression e do grupo Gene Regulation, pelo companheirismo e pelo apoio que me proporcionaram durante o meu trabalho. Obrigada a todos os outros que no IBMC contribuíram de algum modo para o meu trabalho.
A todos os meus amigos que de uma forma ou de outra, me apoiaram durante o percurso da minha tese. À Ana Margarida, à Mafs e ao Fidos, um obrigada pela amizade e pela motivação.
Finalmente, aos meus pais, um agradecimento muito sentido, pelo apoio e paciência permanentes.
FCUP Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
V
II. Abstract
The adaptive immune response of a T cell is initiated upon recognition by the T cell receptor of an antigenic peptide presented by the Major Histocompatibility Complex of antigen presenting cells. Integrating this response there are other signals provided by accessory and co-stimulatory molecules targeting at the immunological synapse (IS). The engagement between APCs and T cells triggers several intracellular signaling pathways, which induce early and late responses of the immune system, culminating with the production/activation of transcription factors in the nucleus of T lymphocytes. The CD6 glycoprotein is one of the molecules present at the IS upon T cell-APC engagement. It binds its physiological ligand, CD166, present at the surface of APCs. CD6 has been generally regarded as a co-stimulatory molecule over the years, but the latest results identified its inhibitory potential upon T cell activation. CD6, in its full length form (CD6FL), was reported to attenuate both early and late responses upon T cell activation, while CD6Cy5, an isoform devoid of the cytoplasmic domain, featured high levels of both calcium and IL-2. These results pointed to the cytoplasmic tail of CD6 as responsible for the inhibitory role of the molecule. Following the latest lead on CD6 involvement as a negative modulator in T cell activation, we aimed to map the CD6 inhibitory determinants within its cytoplasmic tail. In the current project, several isoforms of variable lengths of the cytoplasmic tail were created, having in mind the existence of different tyrosines, which were reported to be phosphorylated during T cell activation. We have performed several studies of early and late responses to activation. Our results suggest that the middle part of the cytoplasmic tail of CD6 is responsible for the inhibitory potential of the molecule, since deletion of this sequence resulted in an increase of calcium fluxes and IL-2 production upon activation of cells through the T cell receptor.
FCUP Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
VI
III. Resumo
A resposta imunológica adquirida de um linfócito T inicia-se após reconhecimento, pelo complexo do receptor dos linfócitos T/ CD3, de um antigénio sob a forma de péptido, apresentado pelo Complexo Maior de Histocompatibilidade. Integrando esta resposta, há sinais adicionais fornecidos por moléculas acessórias e co-estimulatórias que se translocam para a sinapse imunológica (IS). A ligação entre células apresentadoras de antigénio (APC) e os linfócitos T desencadeia diversas vias de sinalização, que incluem respostas iniciais e tardias do sistema imunológico, e termina com a produção de factores de transcrição no núcleo dos linfócitos T. A glicoproteína CD6 é uma das moléculas presentes na IS, após ligação das APC com os linfócitos T. Liga-se ao seu ligando fisiológico, CD166, presente na superfície das APCs. Ao longo dos anos, a molécula CD6 tem sido abordada como uma molécula co-estimulatória, mas os resultados mais recentes identificaram o seu potencial inibitório, após activação dos linfócitos T. Foi observado que a CD6, em todo o seu tamanho integral (CD6FL), atenuava quer as respostas iniciais, quer as tardias, após activação dos linfócitos T, enquanto que a CD6Cy5, uma isoforma sem o domínio citoplasmático, apresentava níveis elevados de cálcio e interleucina-2. Estes resultados apontam para que a cauda citoplasmática da CD6 seja responsável pelo seu papel inibitório. Seguindo a última pista relativamente ao envolvimento da CD6 como um regulador negativo na activação dos linfócitos T, tencionamos mapear as sequências que determinam o papel inibitório da cauda citoplasmática da CD6. Neste projecto, foram criadas várias isoformas com comprimentos diferentes relativamente à cauda citoplasmática da CD6, tendo em conta a existência de diferentes tirosinas fosforiladas por cinases durante a activação dos linfócitos T. Realizamos vários estudos relativos à resposta inicial e tardia, perante activação. Os nossos resultados sugerem que a parte média da cauda citoplasmática é responsável pelo potencial inibitório da CD6, já que não foram induzidos aumentos do fluxo do cálcio ou de produção de interleucina-2 após activação.
FCUP Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
VII
IV. Abbreviations
ALCAM Activated leucocyte cell adhesion molecule
Antigen Ag
AP-1 Activator protein 1
APC Antigen-presenting cell
BSA Bovine Serum albumin
CD Cluster of Differentiation CLL Chronic lymphocytic leukemia
cSMAC Central Supramolecular Activation Cluster
CTL Cytotoxic T lymphocytes
CTLA-4 Cytotoxic T lymphocyte-associated antigen 4
DAG Diaglycerol
DC Dendritic cell
DMEM Dulbecco’s Modified Eagle Medium dSMAC Distal Supramolecular Activation Cluster ELISA Enzyme-linked immunoabsorbent assay
ER Endoplasmatic reticulum
FACS Fluorescence-activated cell sorting
FBS Fetal Bovine Serum
FL Full-length
IL-2 Interleukin-2
IP3 Inositol triphosphate
IS Immunological synapse
ITAM Immuno tyrosine-based activation motif ITIM Immuno tyrosine-based inhibitory motif Itk Interleukin-2-inducible T-cell kinase LAT Linker for activation of T cell
LB Lysogeny broth
Lck Lymphocyte-specific tyrosine kinase
LPS Lipopolysaccharide
LTA Lypotheichoic acid
mAb Monoclonal antibody
MAPK Mitogen-activated protein kinase
MC Microcluster
MS Multiple Sclerosis
NFAT Nuclear factor of activated T-cells NF-kβ Nuclear factor kappa B
Opti-MEM Optimal-Minimal Essential Medium PAMP Pathogen-associated molecular patterns
PBS Phosphate Buffered Saline
PCR Polymerase chain reaction
PHA Phytohaemagglutinin
PIP2 Phosphatidylinositol 4,5 – biphosphate 2
PKC Protein Kinase C
PLC Phospholipase C
pMHC Peptide-complexed Major Histocompatibility Complex PMSF Phenylmethylsulfonyl Fluoride
FCUP Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
VIII
PRR Pattern recognition receptors
pSMAC Peripheral Supramolecular Activation Cluster PTP Protein tyrosine phosphatase
RPMI Roswell Park Memorial Institute
SDS-PAGE Sodium dodecyl sulfate - polyacrylamide-gel-electrophoresis
SH2 Src Homology 2
SHP-1 Src homology phosphatase-1
SLP-76 SH2-domain containing leucocyte-76 SMAC Supramolecular Activation Cluster SNP Single nucleotide polymorphism
SRCR-SF Scavenger receptor cysteine-rich superfamily
SS Sjögren’s Syndrome
Syk Spleen tyrosine kinase
TBS-T Tris-buffered saline 1%Tween
TCR T cell receptor
Th T helper
V. Table of Contents
I. Agradecimentos...IV II. Abstract...V III. Resumo...VI IV. Abbreviations...VII V. Table of Contents...IX VI. Figures List...XI VII. Tables List...XI1. Introduction...1
1.1. Introductory Notes...2
1.2. T cell surface receptors...3
1.3. TCR/CD3 complex...4
1.4. Balance between kinases and phosphatases...5
1.5. Co-receptors CD4 and CD8...6
1.6. CD28 and CTLA-4...7
1.7. The Immunological Synapse...8
1.8. TCR triggering and T cell activation...9
1.9. Scavenger Receptor Cysteine-Rich superfamily...11
1.9.1. CD5...12
1.9.2. CD6...13
2. Materials and Methods...19
2.1. Cloning...20
2.2. Transformation and miniprep...21
2.3. Cell lines...21
2.4. Stable cell line production...22
2.4.1. Virus assembly...22
2.4.2. E6.1 infection...22
2.4.3. Assessing infection efficiency...22
2.6. Sorting...23
2.8. Activation Assays...24
2.8.1. Calcium flux variation...24
2.8.2. Interleukin-2 production...24
3. Results...25
3.1. Stable cell line production...26
3.2. CD3, CD5 and CD6 expression...28
3.3. Sorting...29
3.4. Western-Blotting...29
3.5. Activation assays...30
3.5.1. Calcium flux assays...30
3.5.2. Interleukin-2 production...31
4. Discussion...34
5. Conclusion...39
VI. Figures List
Figura 1 – The Immunological Synapse (Page 3) Figura 2 – CD6-CD166 Interaction (Page 15) Figura 3 - CD6 protein mutants (Page 20)
Figura 4 – CD6 expression levels, given by the amount of citrine fluorescence, in E6.1 cells infected with virus particles (Page 26)
Figura 5 - Flow cytometry analysis of sorted infected E6.1 cells (Page 27) Figura 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression (Page 28) Figura 7 - Flow cytometry analysis of cells labeled for CD3 and CD6 (Page 29) Figura 8 – Western-Blot (Page 30)
Figura 9 – Calcium activation assays (Page 32) Figura 10 – IL-2 activation assays (Page 33)
VII. Tables List
1.1. Introductory Notes
The immune system is responsible for the host defense against disease. When facing pathogens and other invaders, it is capable of protecting the host by discriminating foreign organisms from endogenous cells, without causing any damage of the host’s tissues and organs. The extremely complex molecular machinery intrinsically involved in the process of defense is intensively studied in order to figure out strategic therapies and to develop vaccines to avoid infectious and inflammatory diseases, autoimmunity or even cancer, worldwide causes of mortality.
In mammalians, there are two lines of defense, the innate and the adaptive. The first line of defense to act upon invasion of a pathogen consists of the innate response. It is mediated by the performance of a particular type of receptors, the pattern recognition receptors (PRRs). These recognize broad groups of pathogens in a non-specific manner and target the pathogen-associated molecular patterns (PAMPs). Not only are PRRs able to stimulate tissue-resident macrophages to produce cytokines, as they may kill viruses or act by phagocytosis of fungi. Therefore, PAMPs recognition will trigger inflammation processes. PRR(s) also assure the distinction between self and pathogens, thus avoiding auto-immune diseases of infectious origin. However, in several cases, the innate response may not be sufficient and the host must take advantage of the adaptive immune response, also designated as acquired immune response, which is the second line of defense. The adaptive immune system consists of a diverse network of cells which recognize pathogens specifically. B and T lymphocytes are the cells per
excellence involved in this type of response. Antigens in the form of small peptides
are presented by the major histocompatibility complex (MHC) of antigen presenting cells (APC) in the lymph nodes and spleen, where they are recognized by the B and T cell receptors, respectively, in an antigen-specific manner, leading to the activation of effector mechanisms. The adaptive cells are also gifted with immunological memory. Although the innate and the adaptive response behave very differently, they complement mutually.
A critical event at the beginning of the immune response is T cell activation, mediated by the engagement of the T cell receptor (TCR) with the MHC. The encounter of T cells and APCs triggers a series of signaling events that include proliferation, differentiation and secretion of cytokines and growth factors. The triggering of T cells occurs in a matter of seconds, when a cascade of tyrosine phosphorylations is initiated, while T cell proliferation is a process that requires several hours. T cell activation may result in either an activatory or inhibitory downstream cascade of signaling events, thus maintaining the homeostasis in T lymphocytes [1, 2, 3, 4].
1.2. T cell surface receptors
T lymphocytes expose a diverse group of surface molecules acting as receptors in immune response. These receptors establish interactions with their ligands, located on APCs membrane, through class I or class II MHC molecules (Figure 1), resulting in the formation of the immunological synapse (IS). Yet, there are a number of other molecules that are not directly involved in T cells-APC(s) engagement, but are instead intrinsically involved in intracellular signaling cascades, thus participating in signal transduction from the membrane to the nucleus of T cells.
It has become challenging to study all these molecules involved in the immune response, simultaneously with their interactions. Both gene analysis, mainly by sequencing, and the evolution in the field of microscopy have become major contributors on finding the different T cell molecules and on unveiling their interactions and their roles [5]. In this thesis, I approach the immune system by describing how the surface receptor CD6 of T cells regulates T lymphocyte responses. This chapter presents an overall view of the major constituents of T cells including a brief description of their interactions with their ligands and an understanding on how signaling cross-talk interferes with T cell responses and behavior. I am focusing on several CD6 isoforms to map their inhibitory role on T cell responses [6].
1.3. TCR/CD3 complex
The TCR complex is a multi-subunit receptor complex formed by an heterodimeric structure of α and β chains, or γ and δ chains, coupled to a CD3 set of polypeptides [7], that must recognize antigens and translate this recognition into intracellular signal transduction events [8]. For that matter, two different subunits, able to communicate with each other, can be discriminated: the antigen (Ag) binding subunit and the signal transduction subunit. The Ag binding subunit comprises two transmembrane dissulphide-linked chains, each containing a variable and a constant immunoglobulin-like domain [9]. The constant domain is responsible to anchor the TCR to the membrane. On the other hand, the variable domain is dedicated to the Ag recognition, providing Ag specificity, since it is encoded in separate segments, rearranged randomly [10].
Each TCR is constitutively associated with a CD3 complex, required for membrane expression of the TCR and for signal transduction upon TCR-recognition of Ag. CD3 is composed of four subunits that associate with the TCRαβ in the form of three dimers. They include CD3ελ and CD3εδ heterodimers, and a CD3ζζ homodimer [11]. The transmembrane region of CD3 is negatively charged due to the presence of aspartate residues, allowing these chains to associate with the TCRαβ, positively charged [7].
The cytoplasmic domains of CD3 molecules contain immunoreceptor tyrosine-based activation motifs (ITAMs), which are fundamental to the signaling capacity of the TCR, since no signaling motifs have been found regarding the TCR. Each ITAM has its own role in signaling events. When the TCR engages the peptide/MHC (pMHC) on the APC surface, alterations of the homeostasis occur, promoting the phosphorylation of CD3 ITAMs by Src kinases, such as Lck and Fyn. Several docking sites for Src-homology 2 (SH2) domain-containing proteins are created, allowing the association of -associated chain-70 (ZAP-70). ZAP.70 is a tyrosine kinase which behaves as a key effector on the initiation of the T cell intracellular signaling cascade.
The TCR binds self or foreign peptide on class I or class II MHC molecules. It remains unclear how can the TCR recognize a specific ligand and how it discriminates between the highly similar pMHC(s) present on APC(s) surface [12]. However, the presentation and origin of the antigen were reported to clarify whether the TCR should bind MHC class I or MHC class II, providing two different types of response.
1.4. Balance between kinases and phosphatases
Van der Merwe et al. [8] suggested that there is a balance in resting T cells created between the phosphorylation of ITAMs in the TCR/CD3 complex and the dephosphorylation by phosphatases. However, TCR triggering is thought to occur in favor of ITAM phosphorylation, allowing the initiation of intracellular signaling cascades.
Accordingly, T-cell-APCs engagement leads to phosphorylation of the CD3 ITAMs by Lck and Fyn. Lck and Fyn feature two key tyrosine residues: one at the kinase domain that induces T cell activation and one other at the C-terminal region that, when phosphorylated, inhibits activation since it reduces the kinase activity.
Phosphorylation is accompanied by protein tyrosine phosphatase (PTP) activity.
CD45, one of the most abundant cell surface glycoproteins, with a cell surface occupancy of about 10%, is a PTP expressed by nucleated hematopoietic cells [13]. It features an extremely long and highly glycosylated extracellular region. One of its main roles seems to be the dephosphorylation of the C-terminal inhibitory tyrosine of
Src kinases, which leads to an increase of these kinases’ activity allowing T cell activation, and the dephosphorylation of the positive autocatalytic tyrosine at the kinase domain, which establishes a threshold to the kinase activity during activation [14, 15, 16].
In parallel, other accessory molecules play an important role in T-cell activation. Among them, co-receptors CD4 and CD8, co-stimulatory molecules such as CD28, and adhesion molecules such as CD2, can be identified [17].
1.5. Co-receptors CD4 and CD8
T lymphocytes can be divided into two subpopulations according to the expression of CD4 and CD8 membrane molecules. These receptors are known to co-recognize Ag when the TCR engages different class MHC molecules [7].
Developing thymocytes are double positive since they express both CD4 and CD8, until they undergo positive and negative selection differentiating into CD4+ or
CD8+ T cells [18].
CD8+ T cells define cytotoxic T cells (CTLs) able to recognize Ags associated with
class I MHC molecules. CD8+ T cells recognize and induce the apoptosis of infected
cells, commonly containing viruses or other cytosolic pathogens [9]. CD4+ T cells
define helper T cells (Th) which recognize Ag associated with class II MHC molecules [7]. CD4+ T cells are known to produce cytokines and growth factors,
involved in the adaptive immune response, defending the human body from bacterial infections. A subset of Th cells, Th1, are known to release cytokines and chemokines to recruit macrophages and other phagocytic cells to the site of infection, activating them and leading to the fusion of lysosomes and vesicles containing bacteria. Another subset of Th cells is Th2. These are responsible for the destruction of extracellular bacteria, through activation of B cells. [9].
The different roles attributed to the CD4 and CD8 co-receptors may be explained by the different binding of each one of them to the respective class of MHC molecule. Although both have Ig-like extracellular domains, a single transmembrane domain and a short cytoplasmic tail, they are structurally different, which may explain the different roles they display in the immune response. [7].
These co-receptors present an important role on T cell responses. An effective response depends not only on specific TCR/pMHC engagement but also on the interaction of these receptors with class I or class II MHC molecules. Both co-receptors recruit Lck to their cytoplasmic tail, becoming phosphorylated upon T cell activation and mediating T cell signaling [19].
1.6. CD28 and CTLA-4
T cell activation requires, as previously referred, the engagement of TCR and pMHC. However, the adaptive immune response does not occur in the absence of a second signal provided by co-stimulatory and co-inhibitory molecules, such as CD28 and CTLA-4 (cytotoxic T lymphocyte-associated antigen 4), which allow sustained activation. Blockage of these molecules may take cells to become anergic or even apoptotic. CD28 and CTLA-4 are known as transmembrane glycoproteins, members of the Ig superfamily. Their short cytoplasmic tails contain SH2- and SH3- binding domains involved in signaling events. CD28 was also reported to be constitutively expressed in T cells [20], opposite of what happens with the majority of molecules known to participate in T cell responses.
These molecules share two ligands from B7 family, CD80 and CD86. CD28 and CTLA-4 engagement with their ligands conjugates co-stimulatory and co-inhibitory signals in order to maintain the homeostasis in T cells [21]. Whilst CD28 ligation enhances T cell proliferation; cytokine production, mainly IL-2; transcription factor activation; anti-apoptotic genes up-regulation; cell adhesion enhancement and cell cycle regulation, among other roles, [20, 21, 22], CTLA-4 does the opposite, reducing the IL-2 production and thereafter reducing T cell activation [21].
These co-stimulatory receptors are also essential for the IS formation. [23]. It has been hypothesized that CD28 initiates T cell activation and that, upon T cell stimulation, CTLA-4 is up-regulated and translocates to the cell surface where it displays the inhibitory potential to end, attenuate and also to establish a threshold in T cell responses. CTLA-4 can behave this way because it has a higher competitive advantage for ligand engagement than CD28, due to the higher affinity it shares with either CD80 and CD86 [21].
1.7. The Immunological Synapse
The adaptive immune response is initiated when T cells encounter Ag presented on APCs to form a dynamic and organized interface. The nanometer scale interface created between these two cells is called the immunological synapse (IS) [2]. The immature synapse has its receptors and other membrane proteins rearranged in order to conceive the mature IS [24]. The mature IS was early identified as a supramolecular activation cluster (SMAC) [25], structurally discriminated into three spatially distinct concentric rings. The central SMAC, c-SMAC, is localized at the center of the interface, where the TCR/CD3 complex engages pMHC. The peripheral region, p-SMAC, surrounds the c-SMAC, and was reported to be enriched with adhesion molecules and integrin-associated cytoskeleton proteins [26]. More recently, a more external layer, the distal SMAC, d-SMAC, was also defined as the region of the SMAC where proteins with large ectodomains, such as CD45 PTP, are thought to accumulate. This model, known as bull's-eye rearrangement, is not found at all IS, being absent on those formed with dendritic cells [27]. According to this model, the IS as a SMAC becomes the interface per excellence responsible for antigen recognition and T-cell activation [23]
The accumulation and distribution of receptors in the IS probably occurs by recruiting ligands to the contact site, generating the necessary driving forces to recruit TCR/CD3-pMHC, adaptor proteins, as well as kinases, to the IS. Upon the massive recruitment of receptors to the IS, they form a mature IS [28, 29]. A new hypothesis emerged, based on imaging analyses, that detected small structures present at all immune synapses, containing different receptors, adaptors and kinases. According to this hypothesis, microclusters (MC) were reported to form the moment after pMHC recognition by the TCR complex. TCR-MCs play a role either in antigen recognition as well as in the initiation of T cell signaling events. After their formation and assembly in the peripheric region of the IS, it seems that they tend to migrate to the SMAC, where they accumulate. During the migration to the c-SMAC, they were reported to lose their associations with phosphorylated kinases and other adaptors proteins they are bound to, such as Lck and ZAP-70 [23, 30].
The mature IS forms in an order of minutes, upon T cell-APC contact, while TCR triggering occurs in a matter of seconds [31]. The end of synapse formation was suggested to happen when lack of antigens decreases the continuous production of
peripheral MCs, stopping their translocation to the c-SMAC and thereafter weakening the T cell-APC interaction [23].
1.8. TCR triggering and T cell activation
The recognition of pMHC by the TCR is the key to the process of T cell activation in adaptive immune responses [32]. However, a second signal integrates this response. The engagement of other molecules is required for full T cell activation. Among them, co-receptors CD4 and CD8 and co-stimulatory molecules, such as CD28, have been identified.
It is important to consider the cellular environment surrounding T cell activation, which can be regulated by the cytoskeleton and lipid rafts. The cytoskeleton undergoes several conformational changes modulating its shape during T cell activation, providing motility and dynamic to T cell surface molecules. IS formation, TCR-pMHC engagement, receptor recruitment and signaling events are processes associated with cytoskeleton remodelations. However, lipid rafts also seem to play a role on T cell activation. Lipid rafts are a combination of glycosphingolipids and protein receptors organized in glycolipoprotein microdomains, which compartmentalize cellular processes. Their aggregation, promoted by TCR engagement, makes them the favorite place for the translocation of signaling proteins, such as Lck, ZAP-70 and LAT [33].
TCR triggering is the mechanism per excellence responsible for the initiation of T cell signaling, upon TCR engagement with class I or class II pMHC molecules. Some models emerged, aiming to explain T cell triggering. Aggregation models proposed that the aggregation of TCR-CD3 complex results in the proximity of tyrosine kinases, responsible for ITAMs phosphorylation, allowing triggering of intracellular signaling cascades. Other models reported that this triggering was achieved by conformational changes in the cytoplasmic tail of CD3 molecules, upon TCR-CD3 complex engagement with pMHC. These changes were driven by mechanical forces (ref van der merwe).
A more recent view proposes a different model, the kinetic segregation model. According to this model, T cell triggering occurs as result of the balance created between phosphorylation and dephosphorylation mechanisms. When adhesion molecules attempt to create close contact zones between T cells and APCs, molecules with large extracellular domains, such as CD45, are excluded from the c-SMAC, reducing the phosphatase activity in that region. Small proteins are recruited to the interface, mainly the TCR/CD3 complex, and this change provided by the phosphatase activity reduction will allow an increase in phosphorylation, resulting in TCR triggering, which is the starting point of T cell activation [34]. However, it remains unexplained whether the CD45 phosphatase exclusion is sufficient to induce the TCR triggering [8].
T cell activation is a process that comprises several steps. The first one is called T cell polarization (1), during which the migration of both T cells and APC(s) are mediated by chemokines. This process is not only important to the IS formation but also to provide Ag recognition. Following polarization, adhesion (2) between T cells and APCs must occur in order to facilitate TCR engagement, by creating an optimal distance between the two cells. Along with the contribution of adhesion molecules, TCR engagement (3) is initiated, creating multiple second messengers and inducing cytoskeleton changes to stop the migration of cells. It is important to sustain full activation, which requires transcriptional activation, and to establish the IS. Early signaling (4) is described through several responses, such as intracellular calcium increase and metabolism changes. One of the earliest events in T cell activation is the phosphorylation of ITAMs. Finally, the IS is disrupted (5), allowing T cell activation to end [32].
In the sequence of events involved in T cell activation, from the membrane to the nucleus, there is a balance created by two opposing processes of phosphorylation and dephosphorylation, as previously referred. According to the kinetic segregation
model, when the contact zone between T cells and APCs is optimal, large
ectodomains proteins, such as CD45, are excluded, allowing small proteins to be recruited and to accumulate at the IS. CD3 ITAMs become phosphorylated by Src kinases; phosphorylation is reported to be enhanced by Lck associated with CD4. Phosphorylated ITAMs become binding sites for SH2 domain-containing proteins, such as ZAP-70. ZAP-70 is also phosphorylated by Src family kinases, becoming
activated and capable of phosphorylating other substrates, such as adaptor linker for activation of T cell (LAT) or the SH2 domain-containing leucocyte (SLP-76). This leads to the assembly of multiple adaptor proteins and scaffold enzymes and, simultaneously, to the activation of multiple signaling pathways.
There is an enormous variety of substrates and molecules involved in T cell signaling. Upon receptor stimulation, phospholipase C (PLC) is activated and produces diacylglicerol (DAG) and inositol triphosphate (IP3), by cleaving phophatidylinositol 4, 5-biphosphate (PIP2). IP3 is a second messenger that releases calcium, an early event in the timeline of T cell responses. When calcium, stored at the endoplasmatic reticulum (ER), is released, cytosolic Ca2+ concentration
increases and binds to calmodulin, which in turn activates the phosphatase calcineurin. Calcineurin dephosphorylates NFAT, allowing it to migrate to the nucleus and activate the expression of cytokines, such as IL-2, so that they promote T cell proliferation. Also, DAG may stimulate protein kinase C (PKC) to promote the initiation of transcription mechanisms. The activation of both NF-B and AP-1 is mediated by PKC. G proteins, present in the lipid rafts, also mediate signal transduction. In the context of T cell signaling, they participate in the MAPK pathway, also promoting the activation of transcription factors at the nucleus [35]. The activation of transcription factors is very important since it will determine the fate of T lymphocytes.
1.9. Scavenger Receptor Cysteine-Rich superfamily
The Scavenger Receptor Cysteine-Rich superfamily (SRCR-SF) of proteins is a highly conserved, stable and ancient family of cysteine-rich type scavenger receptors [36]. This superfamily contains members that are structurally related but share very few functions. Some members such as CD5 and CD6 act as receptors. Moreover, SRCR domains are thought to be involved in different functions, like pathogen recognition, modulation of the immune response, epithelial homeostasis, stem cell biology, and tumor development [37].
The SRCR-SF contains more than 30 members, described mainly in mammals, but also in vertebrates and algae [38]. Typically, SRCR-SF members are expressed in cells belonging to the immune system: B cells, T cells, macrophages, among
others. However, some members are expressed in several tissues and organs, such as the liver, kidney, placenta, stomach, brain and heart [37], and this epithelia and mononuclear-phagocytic system expression suggests a potential role in mucosal defense. SRCR-SF members are classified based on the exon organization and localization and the number of cysteines in each SRCR domain. Accordingly, type A domains are encoded by two exons and contain six cysteine residues, whereas type B domains are encoded by a single exon and contain eight cysteine residues. CD5 constitutes an exception since it is a type B SRCR member containing six cysteine residues [38].
Due to its diversity, the precise function of SRCR proteins is yet to be discovered. Since these members seem to play an important role on both innate and adaptive immune systems, it becomes of crucial importance to explore the role(s) of this SF [39, 40].
1.9.1. CD5
CD5 is a surface receptor, member of the SRCR superfamily [41]. CD5 is expressed on thymocytes, mature peripheral T cells, on B cells derived from B-CLL [42] and also in a sub-population of B cells, B-1a cells [43]. It comprises an extracellular region of three scavenger domains, a hydrophobic transmembrane region and a highly conserved cytoplasmic domain [41]. The cytoplasmic domain contains several threonine/serine and tyrosine residues, potential sites of phosphorylation upon TCR/CD3 complex stimulation [44]. There are four tyrosine residues in the CD5 cytoplasmic tail at positions Y378, Y429, Y441 and Y463. Y378 is within a tyrosine-based inhibitory motif (ITIM). The middle tyrosines, Y429 and Y441, form an imperfect ITAM and they are the main targets of phosphorylation [45]. Upon tyrosine phosphorylation, binding sites for SH2 domain-containing molecules are formed [46]. SHP-1 is a phosphatase able to bind SH2 domain-containing proteins, thus being able to associate with the CD5 cytoplasmic tail. The sequence involved in the binding of SHP-1 was mapped to Y378. It is known that, upon TCR/CD3 stimulation, SHP-1 association with CD5 increases, thus cooperating with the inhibitory role of CD5 in T cell signaling [47]. Also, CD5 was reported to interact with molecules present on the APC surface, such as CD72 [48]; it has its SRCR-D3 domain binding to CD2, an adhesion molecule present on the T lymphocyte surface [44]. CD5 associates through its extracellular region to CD6, also a member of the
SRCR-SF [49]. Although CD5 has its extracellular and cytoplasmic regions binding other molecules, no physiological ligand at the APCs was independently confirmed to bind CD5.
The CD5 signaling pathway involves the participation of Src family kinases, such as Lck and Fyn, Ca2+/calmodulin-dependent kinases [50], RasGAP and Cbl [51, 52], among others. These mediators down-modulate T cell activation helping to establish the main role of CD5 [53]. CD5 was reported to accumulate at the IS, the place of excellence where molecules are recruited to during T cell activation [54].
Early studies reported CD5 as a dual modulator involved in T cell activation since it was thought to act both as a co-stimulatory and inhibitory receptor. Moreover, initial studies describe CD5 as an enhancer of TCR-mediated cell proliferation [55]. However, CD5 is now considered an inhibitory molecule. Thymocytes from CD5 deficient mice showed a higher proliferation rate and increased free cytoplasmic Ca2+
concentration upon TCR/CD3 stimulation [56]. Also, other studies pointed CD5 as a major down-modulator involved in T cell activation processes [53]. The inhibitory function of CD5 was described to be dependent on the functional integrity of its cytoplasmic tail [57]. It has been suggested that SHP-1 is involved in this function, since it binds SH2 domains, upon phosphorylation,. Recently, Bamberger et al. proposed an alternative pathway mediated by Src family kinases [53]. According to this model, early T cell signaling comprising effectors such as ZAP-70, are inhibited via a parallel pathway of CD5. CD5 is able to associate with Fyn in lipid rafts, allowing Fyn phosphorylation in the C-terminal inhibitory tyrosine residue followed by a reduction of Fyn activity. Thereafter, the activation of ZAP-70 is down-regulated [53]. Lck has been considered as the main kinase interacting with CD5 although others may complement its function.
1.9.2. CD6
CD6 is a type I membrane glycoprotein that participates in the fine-tuning of T cell responses [37]. It was first discovered in T cell studies using mAb 12.1 by Kamoun
et al. [58]. CD6 is expressed on thymocytes, on a sub-population of B cells (B-1a), in
some brain cells and in cells derived from chronic lymphocytic leukemia (B-CLL) [51,
59, 60]. CD6 expression increases along the process of thymocyte maturation, being
CD6 belongs to the SRCR-SF [37] like CD5 [41] and SSC5D [62]. As a surface receptor and a member of SRCR-SF, CD6 comprises an extracellular region composed of three SRCR domains, a small transmembrane domain and an unusually long cytoplasmic tail [37, 63, 64, 65]. CD6 has a molecular weight of about 105-130kDa[65] due to heavy glycosylations and phosphorylations [66].
Human CD6 is encoded by 13 exons. First seven exons code for the extracellular and transmembrane domains while the remaining exons code for its cytoplasmic tail [69]. Several CD6 isoforms were reported as result of alternative splicing of the exons coding for the extracellular and cytoplasmic domains [66, 49]. The cytoplasmic tail strongly participates in T cell responses. Although it features no intrinsic enzymatic activity, it is enriched with residues that are phosphorylated during T cell activation and further interact with signaling and cytoskeletal proteins [37, 70]. The cytoplasmic tail of CD6 has tyrosine [63], threonine and serine residues which can be phosphorylated, as well as two proline-rich sequences established as docking sites for SH3 domain-containing proteins [66, 69].
Lymphocytes have multiple accessory molecules on their surface, which have a relevant role in T cell responses. CD6 and CD5 were reported to be closely related accessory molecules [70]. In humans, the CD6 gene was reported to map at chromosome 11q12.2, close to the gene coding for CD5 [67, 71]. While CD5 transcription regulation upon T cell activation has been intensively studied, CD6 has only been reported to be transcriptionally regulated by RUNX1/3 and Ets-1, transcription factors that bind the CD6 promoter region in T cells and appear to regulate conserved mechanisms [72, 73].
When compared with other T cell receptors, the accessory molecules CD5 and CD6 display a very similar structure and expression pattern [50, 74]. As they have homologous extracellular regions, it seems understandable that they also share similar roles on T cell activation and differentiation [51, 75, 76, 77]. Yet, their cytoplasmic domain is very distinct [53]. CD6 presents an important role in the regulation of CD5 tyrosine-phosphorylation. It is known that CD5 has the ability to unusually associate with tyrosine kinases from different families, such as Src family kinases Lck and Fyn, Syk family kinase ZAP-70, and Tec family kinase Itk, which may be explaining its possible inhibitory role. CD6 may have an activatory role over CD5 [49]. CD5 has also been reported to behave as a negative modulator in T cell activation [78] and CD6 seems to induce CD5 tyrosine-residues phosphorylation [37],thus increasing the CD5 inhibitory activity [79]. Moreover, the CD6 and CD5
co-localization [37, 56, 24] at the IS reinforced the idea of an inhibitory role shared by both scavenger receptors.
CD6-CD166 interaction
CD166 or ALCAM (Activated leukocyte cell adhesion molecule), is the counter receptor for CD6. It is located on the APC membrane [80, 82], comprises five Ig extracellular domains [69] and is expressed in hematopoietic (activated lymphocytes, macrophages, dendritic cells, thymic epithelial cells) and non-hematopoietic (epithelial, endothelia, neurons, fibroblasts, etc.) cells [69, 81]. CD166 is the first described immunoglobulin-like receptor to bind to a cysteine-rich domain [56]. Binding of CD6 to CD166 is both unusual and specific, since T cell receptors are known to bind their ligands in a “head to head” manner and CD166 binds CD6 on its most membrane-proximal domain, the third domain (Figure 2). The first evidence that the membrane-proximal SRCR domain of CD6 bound to CD166 was described by Whitney et al. [65]. As result of studies using an alternative spliced isoform without the exon 5, thus lacking the third extracellular domain of CD6, it was discovered that the CD166 N-terminal region (D1) binds laterally to the third extracellular SRCR domain (SRCR-D3) of CD6 [83, 60]. The CD6-CD166 interaction targets CD6 to the center of the IS [49, 84], where it plays a dual role by improving early and stable adhesion between lymphocytes and APCs, and by modulating the later proliferative responses of lymphocytes [56, 85]. Accordingly, blocking this interaction with specific antibodies reduces T cell-APC contacts and both molecules no longer target to the IS. The other two SRCR domains of CD6, D1 and D2, may also be responsible for yet non-described and unknown functions of CD6.
Figure 2 – CD6 and CD166 engagement
T cell signaling
Once TCR-pMHC engagement occurs, along with a second signal provided by co-stimulatory molecules, T cell activation is initiated. At the beginning of this process, tyrosine-residues of CD6 cytoplasmic tail become phosphorylated by Src kinases, such as Fyn and Lck [6]. Upon phosphorylation, SH2 domain-containing proteins such as ZAP-70, an important effector in T cell activation, are recruited as well as the positive regulator SLP-76, which binds the CD6 tyrosine residue Y662 [86]. SLP-76 also interacts with molecules activating the PKC and MAPK pathways [73]. Syntenin-1 is another adaptor protein able to bind signal transduction effectors and cytoskeletal proteins. It seems to be a good candidate for binding to the CD6 cytoplasmic tail since it was reported to accumulate at the IS, similarly to CD6 [87]. Both adaptor proteins are controlled by phosphorylation of the CD6 C-terminal region. Cross-linking CD6 with Abs or with its own physiological ligand CD166 was reported to activate molecules involved in the MAPK pathway, and also the AP-1 and NF-B transcription factors [37, 79].
CD6 biological function
CD6 was regarded as co-stimulatory molecule able to deliver signals to cells [39,
interactions [69]. Accordingly, studies that consist of cross-linking CD6 with monoclonal antibodies suggest a similar positive regulatory activity of CD6 in T cell responses [64]. Other studies also suggested that CD6 participates on thymocyte maturation [69] because during thymocyte development, CD6-depending signals contribute to thymocytes survival and positive selection [40]. Moreover, CD6 long term engagement with CD166 is crucial for T cell proliferation induced by dendritic cells, since it recruits them to DC-T cell contact zones [85]. T cell proliferation is also enhanced when CD6 acts as a co-stimulatory molecule capable of synergizing with TCR and co-stimulatory CD28 [56].
On the other hand, in a study using mAbs OX126 and 3A6, which bind CD6-d3 and CD166 respectively, opposite results were obtained. In fact, when using OX126, T cell proliferation was reduced; on the other hand, when using 3A6, the exact opposite happened, suggesting that CD6 has, similarly to CD5, an inhibitory role in T cell activation [6]. A work from 1997, described calcium flux studies using different CD6 isoforms of variable cytoplasmic lengths [89]. It was suggested that the N-terminal half of the cytoplasmic tail of CD6 was critical for calcium mobilization since experiments with a full length isoform of CD6 (CD6 FL) presented no calcium flux variations, and when using shorter isoforms, an increase on calcium flux was observed. However, a work from 2012 that proved CD6 as an attenuator of early and late signaling events on T cells activation, presented a different hypothesis. The CD6 cytoplasmic tail seems responsible for the inhibitory potential, since in its absence, no inhibition occurs [6]. CD6 FL attenuated early and late T cell responses such as intracellular calcium flux and IL-2 production, respectively, in accordance with Kobarg et al. [89] point of view. But, on the other hand, CD6Cy5, an isoform with only five aminoacids in the cytoplasmic tail of CD6, showed no signs of down-modulating T cell activation. In fact, regarding this isoform, there was an increase on intracellular calcium flux levels upon activation with OKT3 and anti-CD28 mAbs.
As an innate response element
CD6 is not only an intermediate of the adaptive immune response. It has been also thought to play a role in the innate response. Since some members of the SRCR-SF act as pattern recognition receptors (PRR) for microbial organisms, CD6 has been suggested to play a similar role in binding pathogen-associated patterns in bacteria and fungi. The work of Sarrias et al.[39] reported that the extracellular part of CD6 may have retained this innate immune ability from ancient member of the SRCR-SF, thus being able to interact with lipopolysaccharide (LPS) from Gram
negative bacteria and with lipoteichoic acid (LTA) and peptidoglycan from Gram positive bacteria, an interaction that triggers MAPK cascades, involved in T cell signaling. CD6 was also reported to be able to aggregate bacteria [38]. These characteristics give CD6 the potential of being regarded as a possible therapeutic target. Not only cells of the innate immune responses, but also T cells, may use the presence of bacterial components through CD6 to recognize PRR's, something essential for the intervention of septic shock or other inflammatory diseases of infectious origin (39, 40]. This has led to an increased survival rate and to the reduction in pro-inflammatory cytokine levels in murine, opening doors to CD6 therapeutic use in human sepsis [37].
CD6 in disease
The determination of CD6’s main role and regulation, simultaneously with the detailed study of the pathways regulated by this molecule, has achieved great importance since CD6 has been associated with diseases, such as cancer and auto-immune diseases. Similarly to CD5, a marker of chronic lymphocytic leukemia (B-CLL) [60], the possibility that CD6 may be used with therapeutic potential or as a diagnostic marker on diseases of significant matter has become real. Studies were developed to explore the therapeutic potential of CD6 (75). It is already known that CD6-CD166 induces synergistic co-stimulation enhancing the intrinsic activity of TCR/CD3 activation pathways. Targeting CD6 without interfering with its ligand reduced T cell activation, proliferation and pro-inflammatory responses, which would allow us to think of CD6 as a possible target for the treatment of auto-immune diseases[84]. In fact, CD6 has been linked to rheumatoid arthritis (RA), Sjögren's syndrome (SS) and multiple sclerosis (MS) [83, 90, 91, 92]. A single nucleotide polymorphism (SNP) in exon 1 of CD6 was reported to be associated with MS [75]. In SS, a soluble form of CD6 is present in high levels in 2/3 of the patients, although there is no correlation between these findings and disease prognosis [92]. CD6 is expressed at high levels in malignant B cells derived from B-CLL [42]. Knowing that CD6 regulates Bcl-2/Bax ratio, protecting B-CLL cells from apoptosis [60], it would be interesting to unveil the reason and role of CD6 expression in this disease. It thus becomes mandatory to elaborate further studies to better understand CD6 as a negative modulator.
The aim of my thesis is to map the inhibitory role of the CD6 within its cytoplasmic tail.
2. To map within the cytoplasmic tail of CD6 the region responsible for its inhibitory properties, six CD6 mutants were created. These isoforms, containing cytoplasmic tails of different lengths, were designated as Cy5, Cy37, Cy70, Cy135, Cy179 and FL (Figure 3), being FL the isoform corresponding to the full length protein, and in all the others the number corresponds to the number of cytoplasmic amino acid residues present.
Figure 3 – Schematic representation of the six CD6 protein mutants generated by stably expressing the constructs in E6.1 Jurkat cells.
2.1. Cloning
Prior to my work, cDNA corresponding to each of the six isoforms was amplified from genomic DNA by Polymerase Chain Reaction (PCR), using a forward primer containing an AscI restriction site and a Kozac sequence. This primer spans the ATG start site and was common to all isoforms. Reverse primers were specific to each of the isoforms and contained a BamHI restriction site (Table I).
Primer name Sequence (5’-3’)
CD6_ATG(AscI) forward TAGTAGGGCGCGCCGCCACCATGTGGCTCTTCTTCGGGATCA CD6Cy5(BamHI)Rev CTACTAGGATCCCTATTATTTCCTTTAATTCTCAAGAGGATGAA CD6Cy37(BamHI)Rev CTACTAGGATCCTTTGGGGATGGTGATG CD6Cy70(BamHI)Rev CTACTAGGATCCCTGGGCGCTGAAGTC CD6Cy135(BamHI)Rev CTACTAGGATCCCCTCGGGTGATACTGA CD6Cy179(BamHI)Rev CTACTAGGATCCCTCCAAGTTTGGGG CD6FL(BamHI)Rev CTACTAGGATCCCTAGGCTGCGCTGATGTCATC Amplified cDNA corresponding to each of the isoforms was cloned, after purification, in a pHR vector containing an ampicillin resistant gene for selection, as well as a citrine gene which is expressed as a fusion protein with our mutants. For cloning, PCR products were digested with AscI (8 h, 37 ºC) and BamHI (2 h, 37 ºC) restriction enzymes (BioLAbs) in NEBbuffer 4. pHR vector was digested with MluI and BamHI enzymes (BioLAbs), for 3 h at 37 ºC. Digestion products were run on a 1% agarose gel to check efficiency, and digested bands were cut and purified with the QiaexII kit (Qiagen) according to the manufacturer’s instructions. Ligation was performed overnight at room temperature, in a 20 µl total volume reaction containing binding buffer and T4 DNA ligase enzyme (Fermentas).
2.2. Transformation and miniprep
TOP-10 competent cells were transformed with 8 µl of ligation product by a heatshock method – 20 min on ice followed by 30 sec at 42 ºC and again 5 min on ice. Cells were grown for 1 h at 37 ºC and then plated on LB plates with ampicillin and left overnight at 37 ºC. After a colony PCR to confirm the insert size of few colonies representing each construct, plasmids were isolated with the PureLink® Quick Plasmid Miniprep Kit protocol (Invitrogen), following the manufacturer’s instructions.
2.3. Cell lines
The Jurkat cell line (clone E6.1) and the kidney adherent 293T cells were maintained in complete Roswell Park Memorial Institute (RPMI) media (Gibco) and Dulbecco's Modified Eagle Medium (DMEM) (Gibco), respectively, with 10% Fetal Bovine Serum (FBS) (Gibco) and 1% penicillin and streptomycin (Invitrogen), at 37 ºC Table I –Sequences of the primers used to amplify CD6 cDNA for cloning
and 5% CO2. Cells were passed every 3 days when approaching confluence.
2.4. Stable cell line production
Stable Jurkat cell lines (clone E6.1) expressing each of the CD6 mutants were produced by lentiviral infection and expression.
2.4.1. Virus assembly
293T cells were transfected with 0.5 µg of each of the three vectors necessary for virus assembly: pMD-G, p8.91 Ex QV and pHR-citrine, the last one cloned with the DNA coding for each of the mutants. In short, 24 h before transfection, 293T cells were counted and plated on a 6-well plate at a concentration of 3 x 105 cells/ml in 2 ml of
DMEM media. The three vectors were transfected in a mix of 4.5 µl lipofectamine (Invitrogen) and 100 µl of Minimal Essential Medium (Opti-MEM) (Gibco). After 30 min of incubation at room temperature, the transfection mix was added to the 293T cells, whose media had been replaced by complete RPMI. Cells were then incubated from 48 to 72 h at 37 ºC to allow virus assembly and production into the supernatant.
2.4.2. E6.1 infection
Virus particles coding for the different CD6 mutants were used to infect E6.1 cells. The virus-containing supernatant of the transfected 293T cells was centrifuged for 5 min at 1200 rpm to remove any contaminating 293T cell, which was then added to 106
E6.1 cells in 4 ml of complete RPMI. Cells were left for 48 h at 37 ºC to allow infection.
2.4.3. Assessing infection efficiency
CD6 is expressed as a fusion protein of CD6-citrine. We have used citrine fluorescence to measure the amount of CD6 being expressed in the infected cells and to assess transfection efficiency by flow cytometry analysis. Cells expressing CD6 were sorted (Fluorescence-activated cell sorting Aria (FACS Aria)) to homogenize the CD6-expression levels within all CD6 mutants.
2.5. CD3, CD5 and CD6 Expression Profile
All CD6 mutant cell lines were analyzed for the expression of CD3, CD5 and CD6 membrane markers, by cytometry, using monoclonal antibodies (mAb) CD3, anti-CD5 and anti-CD6, respectively. In short, 3 x 106 cells of each isoform were used for
each labeling. Cells were collected by centrifugation (1200 rpm for 5 min) and washed with Phosphate Buffered Saline (PBS) (Invitrogen). All samples were ressuspended in 50 µl of FACS buffer (0.2% Bovine serum albumin (BSA) and 0.1% Azide) containing 1
µg of each of the primary mAb - mouse anti-CD3 (OKT3), mouse anti-CD5 (IgG1 Y2/178 (Santa Cruz Biotechnology)) and mouse anti-CD6 (MEM98 (1 mg/ml) (Exbio)); as a negative control, we used 1 µg of OX-54 (anti-rat CD2). Cells with mAbs were incubated for 30 min on ice and then washed twice to eliminate the excess of mAb. Cells were then incubated for 15 min in 50 µl of FACS buffer containing 1 µg of the secondary Ab labeled with Alexa Fluor® 647 (donkey anti-mouse IgG (H+L), Invitrogen). Cells were washed again two times using FACS buffer to remove the secondary Ab in excess and ressuspended in 200 µl of PBS and filtered. Results were analyzed by Flow Jo software (version 8.8.7).
2.6.
Sorting
To ensure that cells were expressing CD6 and CD3 at similar levels, all samples were labeled for these two markers (as explained above) and sorted.
2.7. Western Blotting
The size of the proteins was confirmed by Western-Blotting. Cells lysates were obtained by lysis of 3 x 106 cells with NP-40 lysis buffer (10 mM Tris-HCl pH 7.4; 150
mM NaCl; 1 mM EDTA; 1% (v/v) NP-40) containing PMSF (1 mM) (Sigma) for 30 min on ice. Samples were centrifuged at high speed for 10 min at 4 ºC. The supernatant was kept and mixed with 2x Laemmli Sample buffer (BioRad). Samples were denaturated for 5 min at 95 ºC and kept at -20 ºC
Lysates were loaded on a 10% SDS-polyacrylamide gel (SDS-PAGE) and separated for 1 h and 30 min at 150 V. Samples were transferred to a nitrocellulose membrane in an iBlot equipment (Invitrogen), according to the manufacturer’s protocol, which was then blocked in a solution of 5% non-fat dry milk in Tris-Buffered Saline and 1% Tween (TBS-T) (20 mM Tris-HCl; 137 mM NaCl; 0,1% (v/v) Tween 20 (10%); pH 7.6), for 1 h at room temperature. The membrane was incubated with the primary anti-CD6 Ab (Anti-Human anti-CD6 Purified 1 mg/ml clone MEM98 (Exbio)) in a solution of 3% non-fat dry milk in TBS-T, overnight at 4 ºC. After a series of 5 min washes with TBS-T, the membrane was incubated for 1 h at room temperature with the secondary Ab (goat anti-mouse IgG-HRP 200 µg/0.5ml (Santa Cruz Biotechnology)) in a solution of 3% non-fat dry milk in TBS-T. ECL solution (GE Healthcare) was used for developing, after which the membrane was exposed to an X-ray film.
2.8. Activation Assays
Jurkat E6.1 cells expressing each of the different CD6 mutants were used to perform activation studies. Analysis of intracellular calcium mobilization and interleukin 2 (IL-2) production, early and late activation responses respectively, were performed.
2.8.1. Calcium flux variation
Intracellular calcium fluxes were measured on Jurkat E6.1 cells expressing the different CD6 mutants, as well as CD6 full length. Samples were loaded with 5 µM of Fluo-3 (Invitrogen), a molecular probe capable of binding free intracellular Ca2+, for 30 min at 37 ºC. Cells were washed with PBS and analyzed by flow cytometry which gives the variation of fluorescence given by the Fluo-3/calcium interaction upon activation. Cells were monitored for 5 min and activated with 1 µg/ml of mAb anti-CD3 (OKT3) after the first minute. Results are analyzed with FlowJo software (version 8.8.7).
2.8.2. Interleukin-2 production
IL-2 production studies are relevant to monitor T cell activation as a late signaling event. Evaluation of IL-2 production was performed using an Enzyme-linked immunosorbent assay (ELISA assay) (Human IL-2 ELISA KIT II, BD OptEIA), according to the manufacturer instructions. In short, the supernatant of resting and 24 h phytohaemagglutinin (PHA)-activated cells (2 µg), along with the standards, was loaded, in duplicate, into a plate coated with an IL-2 mAb. After a 2 h incubation period and a series of washing steps, a detection solution was added producing an antibody-antigen-antibody “sandwich” and, after another hour incubation and another series of washing steps, a substrate reagent was added to each well and incubated for 30 min, producing a blue color proportional to the amount of IL-2 present in the initial sample. The reaction was stopped turning the blue color into a yellow color, whose absorbance was read at 450 nm, using Biotek software Gen5 (version 1.06).
Aiming to map within the cytoplasmic tail of CD6 the domain responsible for its inhibitory potential in T cells, several CD6 constructs featuring variable cytoplasmic tail lengths were previously created and designated as CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL.
3.1. Stable cell line production
In our constructs, CD6 is expressed as a fusion protein with citrine. We have used citrine fluorescence to assess, by flow cytometry, the levels of CD6 expression in E6.1 transfected cells.
E6.1 cells were efficiently expressing the different CD6 isoforms, except for isoform CD6Cy37 (Figure 4). CD6 expression levels were not uniform within all cell lines and expression of isoforms CD6Cy37, CD6Cy135 and CD6FL was quite low or almost null.
Figure 4 – Flow cytometry analysis: CD6 expression levels (FL-1), given by the amount of citrine fluorescence, in E6.1 cells infected with virus particles containing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6 FL mutants (blue). Plots show that E6.1 cell lines express a low amount of CD6. Non-infected E6.1 cells were used as control (red).
In order to obtain a more homogeneous CD6-expressing population, these cells were sorted for the same level of citrine expression and results are shown in Figure 5.
After sorting, all E6.1 cell lines were expressing CD6 isoforms at good levels when compared with the control. E6.1 cells expressing CD6Cy5 expressed two different populations, one of them with a low amount of CD6.
Figure 5 - Flow cytometry analysis of sorted infected E6.1 cells: CD6 expression (FL-1) of cell expressing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL isoforms. Plots show that CD6 mutants after sorting express higher levels of CD6. Non-infected E6.1 cells were used as control (red).
The expression of CD3, CD5 and CD6 of all cell lines, expressing CD6 mutants, was compared (Figure 6).
Figure 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression in each of the cell lines; anti-rat OX-54 mAb was used as control. CD6Cy5 shows no CD6 expression. All the other cell lines were expressing CD6. All cell lines were also expressing CD5 and CD3. However, the largest CD6 positive population in cells expressing CD6Cy135, CD6Cy179 and CD6FL is not simultaneously expressing CD3. Cells expressing CD6Cy70 show a minimum expression of both CD6 and CD3.
All cell lines expressed high levels of CD3 and CD5 as expected. CD6 expression levels, however, were not homogeneous among the mutants. Cells expressing CD6Cy135, CD6Cy179 and CD6FL showed two populations expressing different levels
of CD6 expression. E6.1CD6Cy5 lost CD6 expression and virus particles with this mutant were used to re-infect E6.1 cells.
3.3. Sorting
To select cells expressing simultaneously similar levels of CD6 and CD3, we sorted CD6+/CD3+ cells that were efficiently obtained and cultured (Figure 7).
Figure 7 – Flow cytometry analysis of cells labeled for CD3 and CD6. A) CD6-citrine expressing cells B) E6.1 cells
express CD3, labeled with Alexa-Fluor 647. C) Gate of CD3 and CD6 positive cells to be sorted. D) A 99% pure double positive CD6/CD3 population was obtained.
3.4. Western-Blotting
The relative size of the CD6 mutant proteins was confirmed by Western Blot, using CD6 mutant cell lysates (Figure 8).
In Figure 8-A, one can see that, as expected, E6.1 Jurkat cells do not show any band since in these cells the levels of CD6 are minute. All other cells have a band corresponding to the approximate size of the protein of each transfected mutant. In
Figure 8-B, E6.1 cells transfected with pHR-citrine without CD6 also shows no band,
as all CD6 expressed is the endogenous, and as said before, the levels are minute. No band could be detected for the mutant CD6Cy70 and this is probably due to a technical
problem since one can see in Figure 8-A that this isoform is being expressed. Western-Blot analysis confirmed that each of the cell lines is expressing the CD6 mutant protein with the expected size. In -B, some extra bands were detected concerning CD6Cy37 and CD6Cy179 isoforms probably corresponding to unspecific products. No bands could be seen regarding CD6Cy5 isoform (Figure 8-B), which is not at all surprising since, as said before for FACS analysis, E6.1 CD6Cy5 in culture loses CD6 expression.
Figure 8 - Western-Blot. A) Relative sizes CD6Cy37, CD6Cy70, CD6Cy135 and CD6FL proteins. B) Relative sizes of CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL proteins.
3.5. Activation assays
Activation assays were performed to study the CD6 inhibitory role in early and late T cell responses.
3.5.1. Calcium flux assays
Early response assays were based on calcium immediate release into the T lymphocyte cytoplasm upon TCR/CD3 complex activation. Due to some technical problems, we were not able to perform calcium assays using all the isoforms simultaneously.
Figure 9 shows calcium flux analysis of five CD6 isoforms: CD6Cy5, CD6Cy37,
activation for cells expressing the CD6Cy5, CD6Cy70 (Figure 9-A) and CD6Cy37 (Figure 9-B) isoforms. On the other hand, cells expressing CD6Cy179 isoform and CD6 FL have no variation on calcium levels upon activation (Figure 9-B).
Regarding the ratios between the basal and the highest calcium levels of cells upon activation calcium variation was higher on cells expressing CD6Cy5, and CD6Cy70, and lower for cells expressing CD6Cy37. CD6DCy179 and CD6FL isoforms presented almost no variation on calcium flux for the last two (Figure 9-C).
3.5.2. Interleukin-2 production
Late response activation assays were based on the production of IL-2 responsible for T cell proliferation. Due to technical problems, we were not able to perform IL-2 assays using all isoforms simultaneously.
Levels of IL-2 were similar between all mutant cells when in a resting state (Figure 10-A). After PHA activation, cells expressing CD6Cy5 were the ones with a higher rate of IL-2 production, followed by CD6Cy37, CD6Cy70, CD6Cy135, CD6FL and CD6Cy179 (Figure 10-A).
As expected, IL2 levels were higher upon activation for all cells, except for CD6Cy179. Regarding variation on the production of IL-2 between all mutants, cells expressing CD6Cy5 and CD6Cy37 have the highest levels of IL-2, followed by CD6Cy135, CD6 FL and CD6Cy70. In Figure 10-B), it is possible to see IL-2 variation results given by the ratio between activated and resting cells. The CD6Cy5 isoform presents the highest variation, followed by CD6Cy37, CD6Cy70, CD6Cy135 and finally CD6FL and CD6Cy179 isoforms.
Figure 9 – A) Calcium flux levels upon activation of cells expressing CD6Cy5, CD6Cy70 and CD6Cy179 isoforms. The CD6Cy5 isoform presents the highest levels on calcium flux followed by CD6Cy70 isoform. The CD6Cy179 isoform presents no calcium flux. B) Calcium flux variation upon activation of cells expressing CD6Cy37, CD6Cy179 and CD6FL isoforms. The CD6Cy37 isoform is the only isoform that presents significant calcium flux, since CD6Cy179 and CD6FL present none. C) Ratio of calcium variation upon activation of cells expressing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy179 and CD6FL isoforms.
Figure 10 – ELISA assay results. In the vertical axis are represented the values of concentration in pg/ml. A) Analysis of the IL-2 production on resting and PHA activated cells variation, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL isoforms. B) Analysis of the IL-2 variation, calculated by the ratio between PHA activated cells and resting cells, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6CFL isoforms.
