Vol-7, Special Issue3-April, 2016, pp794-801 http://www.bipublication.com
Research Article
Downregulation of IL-10R1 and IL-10R2: a Possible Strategy by which the
Intermediate Host Struggles to Control Toxoplasma
gondii Infection
Nader Pestechian1, Hosein Khanahmad Shahreza2,
Ahmad Daryani3, Hosein Ali Yousefi4, Hamed Kalani5*
1,4,5. Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
2. Department of Genetics, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
3. Toxoplasmosis Research Center
, Mazandaran University of Medical Sciences, Sari, Iran.
* Corresponding author: Hamed Kalani, E-mail: [email protected]
ABSTRACT
In this study 50 BALB/c inbred mice were divided into 5 groups, four of which, considered as test groups, received separately excretory/secretary product (ESP) from cell culture medium, the ESP from cell free medium, T. gondii lysate product (TLP), and live tachyzoite. The fifth group was considered as control and received phosphate buffered saline (PBS). Then, the mice peritoneal leukocytes were collected separately and their total RNA was extracted, converted to cDNA and the gene expression level of IL-10R1 and IL-10R2 was evaluated for the test groups using Q-RT-PCR method relative to the control group. The findings showed a significant statistical difference for the gene expression level of IL-10R1 in the groups of the ESP from cell free medium (P=0.032) and live tachyzoite (P=0.048). Relating to IL-10R2, the difference of the gene expression level was significant statistically for the groups of the ESP from cell culture medium (P=0.044) and the live tachyzoite (P=0.012). The genes expression level of IL-10R1 and IL-10R2 was also not significant for the other groups (P>0.05). Taking into consideration that T. gondii increases the production of IL-10, therefore, high production of IL-10 is incompatible with the down regulation of its receptors (IL-10R1 and IL-10R2), and consequently, the supposition here is that probably the host immune system struggles to decrease the genes expression level of IL-10R1 and IL-10R2 in the infected cell to limit the parasite biological activities.
Keywords: IL-10R1; IL-10R2; Toxoplasma gondii; Gene expression
1. INTRODUCTION
The monospecies parasite, Toxoplasma (T.) gondii, is a parasitic protozoan infecting nucleated cells of warm-blooded vertebrates (Yanet al. 2016). Since one-third of the world’s population is to be infected with this parasite and in view of that the infection in immunocompetent individuals is usually with no obvious symptoms (Yanet al. 2016), so the possibility of silent epidemics is raised for this infection. In order to survive and proliferate within a host cell, it is crucial for T. gondii to invade it actively; otherwise passively entered
established by the parasite (Blader and Saeij 2009). This parasite is capable of producing various types of antigens each with a particular function to simultaneously induce both humoral and cellular immune responses (Meissner and Soldati 2005; Behnkeet al. 2008; Johnet al. 2010). Given that the parasite invasion process usually takes less than 30 seconds, therefore, the host cell has not enough time to react and inhibit it (Drewry and Sibley 2015). Several studies showed that T. gondii releases various molecules called excretory/secretary product (ESP) or excretory/secretary antigens (ESA) (Son and Nam 2001; Daryaniet al. 2014). This product is typically consisted of the contents of three organelles including rhoptery, dens granule, and microneme (Dlugonska 2008). Many studies have focused on the use of the ESP to find out a protective vaccine against T. gondii; however, they were failed even in the experimental studies (Daryaniet al. 2003; Costa-Silvaet al. 2008; Zhenget al. 2013) because of the fact that some of the molecules released by this parasite have negative regulatory effects on the production of some cytokines involved in the T. gondii infection (Meloet al. 2011). The aforementioned mechanism is crucial for the parasite survival within the infected cell (Laliberte and Carruthers 2008; Blader and Saeij 2009). Most importantly, it has been demonstrated that this parasite is armed with a considerable number of miRNAs, the molecules acting as gene expression regulatory factors, to manipulate the infected cell genome (Wanget al. 2012; Sacaret al. 2014). Many aspects of the host-T. gondii interaction are still unknown and the studies cited above focused on the live parasite, not its products. Therefore, this study was aimed at examining whether or not the genes expression level of IL-10R1 and IL-10R2 would change in mice that have received the live tachyzoite of T.
gondii or its products.
2. MATERIALS AND METHODS Parasite
T. gondii tachyzoite, strain RH, was used in this study. This parasite was regularly subculture onto murine fibroblast cell culture, or was being
maintained in laboratory mice, and also kept as cryopreserved (Daryani et al. 2014).
Mouse
Swiss Webster out bred mice was used in this study to maintain the parasite in laboratory conditions. In addition, female BALB/c inbred mice, 8-week-old, 20-25 grams, were used for the experiment. The use of the mice was approved by the university research ethics committee (UREC) of the Isfahan University of Medical Science. Additionally, the care and use of the mice was complied with local animal welfare laws, guidelines and policies.
T. gondii lysate product (TLP)
A high yield of tachyzoites was harvested from the murine fibroblast cell culture and three times washed with RPMI-1640 medium (Gibco, Inc.) by centrifugation at 1500×g, 4 °C, for 10 min. The number of tachyzoites was adjusted to 1×107 parasites/ml of RPMI-1640 medium in separate centrifuge tubes. The tubes were placed into an ultrasonic bath filled with cold water (2-4 °C) to disrupt tachyzoites by sonication at 25 kHz, 30 s on and 10 s off for 5 min. Then, the tubes were centrifuged at 15000×g, 4 °C, for 15 min to precipitate the debris. Afterwards, the supernatants of the tubes were collected, pooled, sterile filtered using 0.22-µm pore size filters (Denville, Inc.) and stored as the TLP at -20 °C until use. To be with no alteration, no protease inhibitor was added to this product.
The ESP from cell culture medium
The total peritoneal leukocytes were harvested from Swiss Webster mice and three times washed with RPMI-1640 medium by centrifugation at 1500×g, 4 °C, for 10 min. The number of the leukocytes was adjusted to 4×106cells/well of 24-well cell culture plates to which live tachyzoites were added at a ratio of 2:1 (tachyzoite: leukocyte). The plates were incubated at 37 °C, 5% CO2 and 95% humidity
inhibitor nor fetal bovine serum (FBS) was used for the preparation of this product.
The ESP from cell free medium
The freshly harvested tachyzoites from the murine fibroblast cell culture were three times washed with RPMI-1640 medium (Gibco, Inc.) by centrifugation at 1500×g, 4 °C, for 10 min. The number of tachyzoites was adjusted to 3×106 parasites/ml of RPMI-1640 medium in separate centrifuge tubes. The tubes were placed in a shaking incubator at 37 °C under mild shaking for 3 hours. Afterwards, the tubes were centrifuged at 15000×g; 4 °C, for 15 min and the supernatants were harvested, pooled, sterile filtered using 0.22-µm pore size filters and stored as the ESP from cell free medium at -20 °C until use. To be with no alteration, no protease inhibitor was added to this product. Lyophilization and measurement of protein concentration
The ESPs from cell culture and cell free media as well as the TLP were lyophilized in the presence of trehalose (Sigma Inc.) at a ratio of 5% (w/v) (Jain and Roy 2009). Each of the lyophilized products was reconstituted with 2 ml of phosphate buffered saline (PBS; pH: 7.4) and their protein concentration was measured using Bradford method before use (Bradford 1976). Injection to mice
Fifty BALB/c inbred mice were divided into 5 groups, four of which were considered as test groups and received separately the ESP from cell culture medium, the ESP from cell free medium, the TLP, and live tachyzoite. The fifth group was considered as control and received PBS. Each of the test groupsreceived100-1000
µg of the respective product for 1-10 mice, respectively, based on their calculated protein amount. In addition, the control group received 100-1000 µl of PBS. Furthermore, the mice in the live tachyzoite group received 1000-10000 live tachyzoites. The injection was performed for all of the groups intraperitoneally. Moreover, except forth live tachyzoite group, the injection in the other groups was carried out once a week for three weeks. For the group of live tachyzoite, the injection was performed only once. No adjuvant was injected to mice.
Peritoneal leukocytes collection
The mice were euthanized three days after the last injection. Afterwards, 5 ml of cold RPMI-1640 medium was injected into the peritoneal cavity of each mouse, aspirated, poured into a tube and centrifuged at 1500×g, 4 °C, for 10 min to precipitate the leukocytes. Afterwards, 2 ml of RNAlater® solution (Qiagen, Inc.) was added immediately to the precipitated leukocytes in each tube to stabilize RNA in the cells. The samples were stored at -20 °C until use.
Total RNA extraction
Total RNA was extracted from the samples using Total RNA Purification Kit (Jena Bioscience, Inc.) in accordance with manufacturer’s instruction. Genomic DNA trace in the samples was eliminated by RNase-Free DNase Set kit (Qiagen, Inc.). The purity and concentration of the total RNA was measured by NanoDrop® ND-1000 spectrophotometer and also by running the samples on 1% agarose gel. The samples were kept at -20 °C until use. Reverse transcription-PCR (RT-PCR)
RT-PCR was used to synthesize complementary DNA (cDNA) from total RNA using AccuPower® CycleScript RT PreMix (dN6) kit (Bioneer, Inc.) according to the instruction recommended by the manufacturer. Random hexamer primers were used for this purpose. RT-PCR was performed in two steps: initially the primers were annealed at 15 °C for 1 min and then cDNA was synthesized at 45 °C for 4 min. Finally, the enzyme reverse transcriptase (RT) was heat-inactivated at 95 °C for 5 min. Primer design
regarding the designed primers have been shown in Table 1.
Table1. The sequences of the designed primers in this study
Slope: Efficiency Sequence
Primer NCBI Reference
Sequence Gene
-3.368: 0.976 CCGAGCCAAGGACCAGGATA
Forward NM_013551.2a
NM_001110251.1b
HMBS
TCAGGTACAGTTGCCCATCTTTC Reverse
-3.375: 0.962 AGGCAGAGTGGTCGGAGGAG
Forward NM_008348.2
IL-10R1
GCTTCTTGAAGACCAGGACTGTAGG Reverse
-3.364: 0.981 CGGACAGGCAATGACGAAATAACC
Forward NM_008349.5
IL-10R2
GAGGGAAGGAGAACAGCAGAAAC Reverse
a,bTwo transcript variants of HMBS mRNA
sequence get aligned by MEGA4 and the respective primers were designed according to their homologous regions
Quantitative real time-PCR (Q-PCR)
Q-PCR was performed by Applied Bio systems Step One™apparatus. The reactions were carried out by qPCR Green Master kit (Jena Bioscience, Inc.). Time and temperature required for PCR were: the initial denaturation and polymerase activation at 95°C for 2 min followed by 40 amplification cycles with denaturation at 95 °C for 15 s, annealing-extension at 60.2 °C for 45 s.
3. DATA ANALYSIS
The Kolmogorov–Smirnov (K–S) statistical test was used to evaluate the normal distribution of the data. The melting curve of the amplified genes was examined to verify the accuracy of the reactions. The REST-2009 software (Qiagen, Inc.) was used to analyze the gene expression level of IL-10R1 and IL-10R2 in the test groups relative to the control one based on the calculated efficiency for the primers. Moreover, the statistical difference between the test groups and the control was determined by the aforementioned software. The standard error of
mean (SEM) for ∆Ct of IL-10R1 and IL-10R2 in all of the groups under study was also calculated.
4. RESULTS
The results showed that there was no significant difference statistically forth gene expression level of IL-10R1 in the groups of the ESP from cell culture medium (P=0.348) and the TLP (P=0.209). Furthermore, IL-10R2 gene expression level in the groups of the ESP from cell free medium (P=0.161) and the TLP (P=0.117) was not significant statistically. Moreover, the findings showed a significant statistical difference for the gene expression level of IL-10R1 in the groups of the ESP from cell free medium (P=0.032) and live tachyzoite (P=0.048). Relating to IL-10R2, the difference of the gene expression level was significant statistically for the groups of the ESP from cell culture medium (P=0.044) and live tachyzoite (P=0.012). The obtained valuesforIL-10R1 and IL-10R2 gene expression level in the groups under study have been presented in Figure 1. Moreover, the standard error of mean (SEM) for
∆Ct of IL-10R1 and IL-10R2 in all of the groups has been shown in Table 2.
Table2. The standard error of mean (SEM) for IL-10R1 and IL-10R2 in all of the groups.
Average ± SEMa
TLP ESP-CF ESP-CC AT PBS
IL-10R1 IL-10R2 IL-10R1 IL-10R2 IL-10R1 IL-10R2 IL-10R1 IL-10R2 IL-10R1 IL-10R2
0.98±1.06 3.31±1.02 1.91±0.97 1.94±0.9 0.2±0.49 2.18±0.49 1.39±0.54 2.87±0.6 0.24±0.36 0.44±0.64
a
IL-10R1 IL-10R2 0
0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1
TLP
ESP-CF
ESP-CC
LT 0.39
0.2*
0.64
0.35* 0.38
0.38
0.3*
0.18*
R
el
a
ti
v
e
g
en
e
ex
p
er
ss
io
n
Fig.1. IL10R1 and IL10R2 gene expression level in the groups under study relative to the control group.
The columns marked with an asterisk (*) show a significant difference statistically relative to the control group (P<0.05). TLP: Toxoplasma gondii lysate products, ESP-CF: excretory/secretary products from cell free medium, ESP-CC: excretory/secretary products from cell culture medium, LT: live tachyzoites
5. DISCUSSION
It has been demonstrated that in the infection with T. gondii, IL-10 is a crucial factor to inhibit the harmful effects of IFN-γ on the infected host (Neyeret al. 1997). In the infected cell, T. gondii activates directly the signal transducer and activator of transcription factor 3 (STAT3) through a secretary molecule called ROP16 (Butcher et al. 2005; Butcher et al. 2011). The activated STAT3 signaling pathway leads to the up regulation of IL-10 in the infected cell (Saraiva and O'Garra 2010). In addition to IL-10 up regulation, one of the important mechanisms mediated by T. gondii-induced STAT3 is the inhibition of apoptosis of the infected cell (Caiet al. 2014). The results of a study showed that apoptosis in the T. gondii-infected cells will be decreased in the presence of IL-10 (Zhaoet al. 2013). Indeed, the parasite through inhibiting the induction of apoptosis in the infected cell ensures its own survival and multiplication.
Khan et al. (Khan et al. 1995)revealed that T. gondii is capable of inducing and reducing IL-10 and IFN-γ production, respectively. IL-10 is an antagonist for IFN-γ and a study showed that blocking of IL-10 with monoclonal antibody led to inhibitory effects on the T. gondii
production of IL-10 in T. gondii-infected mice occurs in the chronic phase of infection (Brandaoet al. 2009). Furthermore, in the recent study it has been observed that murine spleen cells stimulated with T. gondii produce a high amount of IL-10 (Brandao et al. 2009). It was demonstrated that this parasite decreases the signs of experimental induced allergy by increasing IL-10 production (Jeonget al. 2015). With a literature search, it was found that no studies have been performed until now on the host-T. gondii interaction in relation to IL-10R1 and IL-10R2. In the present study, down regulation of both IL-10R1 and IL-10R2 was observed in the live tachyzoite group. Furthermore, IL-10R1 and IL-10R2 down regulation was observed affected by the ESP from cell free medium and the ESP from cell culture medium, respectively.
According to what discussed above, T. gondii up regulates IL-10 to reduce the immunopathologic effects of cell-mediated immunity, especially IFN-γ effects, on both the infected cell and the host. Taking into consideration that T. gondii
increases the production of IL-10, therefore, high production of IL-10 is incompatible with the down regulation of its receptors (IL-10R1 and IL-10R2) (observed in the present study), and consequently, the supposition here is that probably the host immune system struggles to decrease the genes expression level of IL-10R1 and IL-10R2 in the infected cell to limit the parasite biological activities. However, further studies are needed to clarify if this hypothesis is true or not.
REFERENCES
1) Abdollahi SH, Ayoobi F, Khorramdelazad H, Hassanshahi G, Ahmadabadi BN, Rezayati M. , Ravary A, Shamsizadeh A,Arababadi MK (2013) Interleukin-10 serum levels after vaccination with in vivo prepared Toxoplasma gondiiexcreted/secreted antigens. Oman Med J 28:112-115.
2) Behnke MS, Radke JB, Smith AT, Sullivan WJ Jr,White MW (2008) The transcription of bradyzoite genes in Toxoplasma gondii is controlled by autonomous promoter elements. Mol Microbiol 68:1502-1518.
3) Black MW,Boothroyd JC (2000) Lytic cycle of Toxoplasma gondii. Microbiol Mol Biol Rev64:607-623.
4) Blader IJ,Saeij JP (2009) Communication between Toxoplasma gondii and its host: impact on parasite growth, development, immune evasion, and virulence. Apmis117:458-476.
5) Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254.
6) Brandao GP, Melo MN, Gazzinelli RT, Caetano BC, Ferreira AM, Silva LA, Vitor RW (2009) Experimental reinfection of BALB/c mice with different recombinant type I/III strains of Toxoplasma gondii: involvement of IFN-gamma and IL-10. Mem Inst Oswaldo Cruz104:241-245. 7) Butcher BA, Fox BA, Rommereim LM, Kim
SG, Maurer KJ, Yarovinsky F, Herbert DR, Bzik DJ,Denkers EY (2011) Toxoplasma gondii rhoptry kinase ROP16 activates STAT3 and STAT6 resulting in cytokine inhibition and arginase-1-dependent growth control. PLoS Pathog7:e1002236.
8) Butcher BA, Kim L, Panopoulos AD, Watowich SS, Murray PJ,Denkers EY (2005) IL-10-independent STAT3 activation by Toxoplasma gondii mediates suppression of IL-12 and TNF-alpha in host macrophages. J Immunol 174:3148-3152. 9) Cai Y, Chen H, Mo X, Tang Y, Xu X, Zhang
A, Lun Z, Lu F, Wang Y,Shen J (2014) Toxoplasma gondii inhibits apoptosis via a novel STAT3-miR-17-92-Bim pathway in macrophages. Cell Signal 26:1204-1212. 10) Costa-Silva TA, Meira CS, Ferreira IM,
Hiramoto RM,Pereira-Chioccola VL (2008) Evaluation of immunization with tachyzoite excreted-secreted proteins in a novel susceptible mouse model (A/Sn) for Toxoplasma gondii. Exp Parasitol 120:227-234.
tachyzoites in the murine model. Vet Parasitol 113;123-134.
12) Daryani A, Sharif M, Kalani H, Rafiei A, Kalani F,Ahmadpour E (2014) Electrophoretic Patterns of Toxoplasma gondiiexcreted/secreted antigens and their role in induction of the humoral immune response. Jundishapur J Microbiol7:e9525. 13) Dlugonska H (2008) Toxoplasma
rhoptries: unique secretory organelles and source of promising vaccine proteins for immunoprevention of toxoplasmosis. J Biomed Biotechnol 2008:632424.
14) Drewry LL, Sibley LD (2015) Toxoplasma actin is required for efficient host cell invasion. MBio6:e00557.
15) Fenoy IM, Chiurazzi R, Sanchez VR, Argenziano MA, Soto A, Picchio MS, Martin V,Goldman A (2012) Toxoplasma gondii infection induces suppression in a mouse model of allergic airway inflammation. PloS one 7:e43420.
16) Gaddi PJ,Yap GS (2007) Cytokine regulation of immunopathology in toxoplasmosis. Immunol Cell Biol 85:155-159.
17) Gazzinelli RT, Oswald IP, James SL, Sher A (1992) IL-10 inhibits parasite killing and nitrogen oxide production by
IFN-gamma-activated macrophages. J
Immunol148:1792-1796.
18) Hunter CA, Sibley LD (2012) Modulation of innate immunity by Toxoplasma gondii virulence effectors. Nat Rev Microbiol 10:766-778.
19) Jain NK, Roy I (2009) Effect of trehalose on protein structure. Protein Sci 18:24-36. 20) Jeong YI, Hong SH, Cho SH, Lee WJ,Lee
SE (2015) Toxoplasma gondiiinfection suppresses house dust mite extract-induced atopic dermatitis in NC/Nga mice. Allergy Asthma Immunol Res7:557-564.
21) John B, Weninger W,Hunter CA (2010) Advances in imaging the innate and adaptive immune response to Toxoplasma gondii. Future Microbiol 5:1321-1328. 22) Khan IA, Matsuura T,Kasper LH (1995)
IL-10 mediates immunosuppression following primary infection with
Toxoplasma gondii in mice. Parasite Immunol17:185-195.
23) Laliberte J,Carruthers VB (2008) Host cell manipulation by the human pathogen Toxoplasma gondii. Cell Mol Life Sci 65:1900-1915.
24) Matowicka-Karna J, Dymicka-Piekarska V,Kemona H (2009) Does Toxoplasma gondii infection affect the levels of IgE and cytokines (IL-5, IL-6, IL-10, IL-12, and
TNF-alpha)? Clin Dev
Immunol2009:374696.
25) Meissner M, Soldati D (2005) The transcription machinery and the molecular toolbox to control gene expression in Toxoplasma gondii and other protozoan parasites. Microbes Infect7:1376-1384. 26) Melo MB, Jensen KD,Saeij JP (2011)
Toxoplasma gondii effectors are master regulators of the inflammatory response. Trends Parasitol27;487-495.
27) Neyer LE, Grunig G, Fort M, Remington JS, Rennick D,Hunter CA (1997) Role of interleukin-10 in regulation of T-cell-dependent and T-cell-independent mechanisms of resistance to Toxoplasma gondii. Infect Immun 65:1675-1682. 28) Sacar MD, Bagci C, Allmer J (2014)
Computational prediction of microRNAs from Toxoplasma gondii potentially regulating the hosts' gene expression. Genomics Proteomics Bioinformatics 12:228-238.
29) Saraiva M, O'Garra A (2010) The regulation of IL-10 production by immune cells. Nat Rev Immunol 10:170-181. 30) Son ES,Nam HW (2001) Detection and
characterization of excretory/secretory proteins from Toxoplasma gondii by monoclonal antibodies. Korean J Parasitol 39:49-56.
from infected mice. Parasitol Res86:151-157.
32) Wang J, Liu X, Jia B, Lu H, Peng S, Piao X, Hou N, Cai P, Yin J, Jiang N, Chen Q (2012) A comparative study of small RNAs in Toxoplasma gondii of distinct genotypes. Parasit Vectors5:186.
33) Yan C, Liang LJ, Zheng KY,Zhu XQ (2016) Impact of environmental factors on the emergence, transmission and distribution of Toxoplasma gondii. Parasit Vectors9:137.
34) Zhao M, Zhang R, Xu X, Liu Y, Zhang H, Zhai X, Hu X (2013) IL-10 reduces levels of apoptosis in Toxoplasma gondii-infected trophoblasts. PloS one 8:e56455. 35) Zheng B, Lu S, Tong Q, Kong Q,Lou D
