[PDF] Top 20 A characterization of the oral microbiome in allogeneic stem cell transplant patients.
Has 10000 "A characterization of the oral microbiome in allogeneic stem cell transplant patients." found on our website. Below are the top 20 most common "A characterization of the oral microbiome in allogeneic stem cell transplant patients.".
A characterization of the oral microbiome in allogeneic stem cell transplant patients.
... Fifty patients scheduled for ASCT were consented to the ...Five patients were not eligible for transplantation due to disease ...progression. Of the remaining 45, eight patients ... See full document
12
Influência do imatinibe no resultado do TMO e sua eficácia no tratamento da recaída.
... assessment in patients with Ph+ chronic myelogenous leukemia at first relapse after allogeneic stem cell transplant: an EBMT retrospective ...analysis. The Chronic ... See full document
5
Allogeneic hematopoietic stem cell transplantation from an alternative stem cell source in Fanconi anemia patients: analysis of 47 patients from a single institution
... all patients received fludara- bine, it was not possible to analyze the influ- ence of fludarabine on ...survival. In our anal- ysis, age and previous infection had no in- fluence on ... See full document
8
Immune reconstitution after allogeneic hematopoietic stem cell transplantation in children: a single institution study of 59 patients
... identify the number of patients with lymphocyte sub set recovery, defined as the 25th percentile of normal val ...impact the re covery of each lymphocyte subset, ... See full document
6
Rapid Recovery of CD3+CD8+ T Cells on Day 90 Predicts Superior Survival after Unmanipulated Haploidentical Blood and Marrow Transplantation.
... hematopoietic stem cell transplantation (Allo-HSCT) is recognized as an effective treatment for patients with hematological ...cells in the early phase after transplantation [3, 4]. ... See full document
17
Chronic graft-versus-host disease : a risk factor for secondary malignancies after allogeneic stem-cell transplant
... besides the severity of cGVHD, long durations of IS, especially those with azathioprine, was an important risk factor for secondary SCC(35); this risk increased after 24 months of combined ... See full document
31
pt 1679 4508 eins S1679
... hematopoietic stem cell neoplastic disease associated with high morbidity and ...mortality. The presence of FLT3 internal tandem duplication mutations leads to high rates of relapse and ... See full document
4
Einstein (São Paulo) vol.15 número3 eins S1679
... hematopoietic stem cell neoplastic disease associated with high morbidity and ...mortality. The presence of FLT3 internal tandem duplication mutations leads to high rates of relapse and ... See full document
4
INCIDENCE OF DIARRHEA BY Clostridium difficile IN HEMATOLOGIC PATIENTS AND HEMATOPOIETIC STEM CELL TRANSPLANTATION PATIENTS: RISK FACTORS FOR SEVERE FORMS AND DEATH
... describe the rate of incidence of Clostridium difficile-associated diarrhea (CDAD) in hematologic and patients undergone stem cell transplant (HSCT) at HC-FMUSP, ... See full document
7
Invasive fungal diseases in haematopoietic cell transplant recipients and in patients with acute myeloid leukaemia or myelodysplasia in Brazil
... new patients with a diagnosis of AML/MDS and all HCT recipients, followed them throughout the entire period of observation, and electronically sent data for each phase of the ... See full document
7
Rev. Bras. Hematol. Hemoter. vol.39 número1
... one of the most common chromosomal abnormalities in adult B-ALL patients and is associated with poor ...Although the use of tyrosine kinase inhibitors (TKIs) target- ing ... See full document
3
Einstein (São Paulo) vol.9 número2
... decrease in frequency and severity of oral mucositis in patients submitted to dental care and laser therapy during allogeneic hematopoietic cell ...records of ... See full document
6
Characteristics of two conditioning regimens cyclophosphamide plus antithymocyte globulin versus cyclophosphamide plus busulfan in allogeneic stem cell transplantation for severe aplastic anemia
... is the standard method to monitor engraftment and rejection. In the present report we have evaluated the product of absolute T cell counts and chimerism, which we have termed ... See full document
2
Rev. Bras. Hematol. Hemoter. vol.30 suppl.2
... monitored in 80 patients with acute lymphoid (ALL, n=44) or myeloid (AML, n=36) leukemia, undergoing allogeneic haemopoietic stem cell ...AML. The overall cumulative incidence ... See full document
3
Fusarium infection in hematopoietic stem cell transplant recipients
... diagnosis of fusariosis was 64 days (range, 1– 1017 days) with a trimodal distribution: a first peak (early fusariosis) before engraftment (median, 16 days), a second peak (late fusariosis) between day 61 and day ... See full document
6
Rev. Bras. Hematol. Hemoter. vol.36 número5
... eradicate the dis- ease. Campregher et al. found that patients with MDS with high-risk IPSS stages treated with DLI have better results than patients with intermediate ...that the major ... See full document
4
en 1980 220X reeusp 49 spe 0093
... Regarding the activity of Administrative/managerial tasks, these are related to the service routine, such as shift work transfer, multiprofessional medical visits, drug sched- uling, nursing process ... See full document
7
A survey strategy for human respiratory syncytial virus detection among haematopoietic stem cell transplant patients: epidemiological and methodological analysis
... by the high mortality rate temporally related to HRSV infections in the HSCT patients ...immunosuppressed patients; however, other respiratory viruses, such as flu, Adv and PIV, also ... See full document
4
Braz. oral res. vol.20 número3
... sets of primer pairs from a genome of Helicobacter pylori strain ...26695. The outer primer pair was 5’CAGTTATTTGGTGGCTACAACCG 3’ and 5’ CCCATCAATAGAGACGCTTAATCC ...3’. The 50 μl of ... See full document
5
Invasive Aspergillosis in Hematopoietic Stem Cell Transplant Recipients: A Retrospective Analysis
... [4]. The Aspergillus galactomannan test was not available at the ...time. The sites of infection were classified as pulmonary, sinusal, cutaneous and ...cerebral. Patients with more ... See full document
5
temas relacionados