[PDF] Top 20 Decreased expression of the ARID1A gene is associated with poor prognosis in primary gastric cancer.
Has 10000 "Decreased expression of the ARID1A gene is associated with poor prognosis in primary gastric cancer." found on our website. Below are the top 20 most common "Decreased expression of the ARID1A gene is associated with poor prognosis in primary gastric cancer.".
Decreased expression of the ARID1A gene is associated with poor prognosis in primary gastric cancer.
... date, the causes of ARID1A silencing have not been fully ...elucidated. The existing studies focus on mutations in ARID1A, particularly in gynecologic ...It is ... See full document
9
Low SIRT3 expression correlates with poor differentiation and unfavorable prognosis in primary hepatocellular carcinoma.
... deacetylases, is implicated in metabolism, longevity and ...SIRT3 expression and its significance in hepatocellular carcinoma (HCC) remain largely ...unclear. In this study, we ... See full document
11
Decreased expression of Beclin 1 correlates closely with Bcl-xL expression and poor prognosis of ovarian carcinoma.
... from the Bcl-2 family, was initially characterized as cell death regulator and has been suggested to control the autophagic process recently ...[18,19]. The deletion of the status ... See full document
10
Activation of Akt/mTOR pathway is associated with poor prognosis of nasopharyngeal carcinoma.
... part in controlling ribosome protein synthesis,and therefore, non- phosphorylated 4E-BP1 binds eIF4E and impedes formation of the initiation complex, blocking translation, favoring apoptosis and ... See full document
7
LSD1 overexpression is associated with poor prognosis in basal-like breast cancer, and sensitivity to PARP inhibition.
... Breast cancer has been classified into four subtypes based on gene expression profile ...breast cancer, one of the subtypes, does not display hormonal receptors and human ... See full document
12
Rankl expression predicts poor prognosis in gastric cancer patients: results from a retrospective and single-center analysis
... Gastric cancer (GC) is the second most commonly diagnosed cancer and the second leading cause of cancer- related deaths in China (1), with the ... See full document
9
Nuclear Ep-ICD expression is a predictor of poor prognosis in "low risk" prostate adenocarcinomas.
... epithelial cancer antigen [5]. It is a glycosylated, 30- to 40-kDa type I membrane protein, expressed in several human epithelial tissues, and overexpressed in cancers as well as in ... See full document
14
Decreased expression of GATA2 promoted proliferation, migration and invasion of HepG2 in vitro and correlated with poor prognosis of hepatocellular carcinoma.
... to the organ systems of endoderm origin. In vivo footprinting study of mouse embryonic endoderm cells has demonstrated occupancy of DNA-binding site for GATA factors on a liver-specific ... See full document
10
The expression of TMPRSS4 and Erk1 correlates with metastasis and poor prognosis in Chinese patients with gastric cancer.
... TMPRSS4 is a TTSP that has been known to be upregulated in several cancers, particularly in pancreatic and thyroid cancers [4,17], and the expression of TMPRSS4 has been ... See full document
7
Silencing of glutathione peroxidase 3 through DNA hypermethylation is associated with lymph node metastasis in gastric carcinomas.
... Gastric cancer remains the second leading cause of cancer-related death in the ...for gastric cancer, generates high levels of reactive oxygen species ... See full document
10
Integrative meta-analysis of differential gene expression in acute myeloid leukemia.
... elsewhere in human AML literature. Although not associated elsewhere with prognosis, HOXB5[65], DAPK1[66], ANGPT1[67], TCF4[68], C3AR1[69], CAT[70], IL6ST[71], JAG1[32], EZR[32], TP53BP2[72] ... See full document
13
Cytoplasmic Skp2 expression is associated with p-Akt1 and predicts poor prognosis in human breast carcinomas.
... levels of Skp2 and reduced levels of p27 occur in various types of cancer, such as gastric carcinoma [5], prostate cancer [6], oral squamous cell carcinoma [7], and ... See full document
9
Decreased galectin-9 and increased Tim-3 expression are related to poor prognosis in gastric cancer.
... confirm the accuracy of semi-quantification by immune- histology, The Western blotting were administrated in gastric cancer cells ...lines. The cells were lysed ... See full document
8
Decreased expression of the FOXO3a gene is associated with poor prognosis in primary gastric adenocarcinoma patients.
... histochemistry. The sections were deparaffinized and rehydrated with graded ...retrieval, the slides were immersed in EDTA (1 mmol/L, pH ...minutes in a microwave oven. After rinsing ... See full document
8
EMAST is associated with a poor prognosis in microsatellite instable metastatic colorectal cancer.
... Colorectal cancer (CRC) carcinogenesis is a multistep process in which different pathways are involved, among which microsatellite instability (MSI) is important ...MSI is characterized ... See full document
13
Correlation of cadherin-17 protein expression with clinicopathological features and prognosis of patients with sporadic gastric cancer
... explore the correlations between cadherin-17 (CDH17) protein expression and the clinicopathological features and prognosis of patients with sporadic gastric cancer ... See full document
10
The Expression of miR-375 Is Associated with Carcinogenesis in Three Subtypes of Lung Cancer.
... (miRNA) is a class of endogenously expressed, noncoding small RNA with around 22 ...regulate gene expression at the post- transcriptional level through imperfect base pairing ... See full document
17
Rev. Assoc. Med. Bras. vol.59 número3 en v59n3a06
... for the pediatric population, but the results with imatinib are similar to those for ...experience with 44 children with newly-diagnosed CML treated with ...imatinib. With ... See full document
13
MicroRNA let-7f inhibits tumor invasion and metastasis by targeting MYH9 in human gastric cancer.
... was gastric cancer tissue and matched adjacent normal stomach tissue, the other was gastric cancer tissue and matched lymph node metastasis ...dewaxed in 60 uC for 2 h, high ... See full document
10
COX-2 gene expression and methylation profile in Sapajus apella as an
... for the methylated fragment; COX2MSPUF 5’ AAATAATTAATATAAACTCCACA AA 3’ and COX2MSPUR 5’ TAGGGAGAGAAATGTT TTAAGGTATATGT 3’ for the unmethylated ...fragment. The MSP approach combines the ... See full document
6
temas relacionados