Top PDF The frequency of CCR5 promoter polymorphisms and CCR5 32 mutation in Iranian populations

The frequency of CCR5 promoter polymorphisms and CCR5 32 mutation in Iranian populations

The frequency of CCR5 promoter polymorphisms and CCR5 32 mutation in Iranian populations

For instance, Gharagozloo et al have evaluated the frequencies of CCR532 mutation in normal population of southern Iran and reported a 0.0146 frequency for CCR532 mutation alleles among the population (20). To the best of our knowledge, the study by Gharagozloo and colleagues is the unique investigation assessing CCR532 mutation in Iranian general population, but several researchers have evaluated this mutation among Iranian individuals with specific diseases or conditions. Azmandian et al have evaluated the role of CCR532 mutation in both acute (AR) and DGF kidney transplant rejection in 100 donor/recipient pairs. Their results showed that CCR532 mutation was neither associated with AR nor DGF in Iranian donor and recipient kidney transplantation (21). In another study, Khademi and colleagues identified the frequency of CCR532 mutation in 156, 125 and 31 Iranian patients with malignant head and neck cancer, squamous cell carcinoma and salivary gland tumors, respectively, in comparison to 262 healthy controls (22). Interestingly, their results also revealed that CCR532 mutation was not prevalent in Iranian patients with malignant head and neck cancer, squamous cell carcinoma and salivary gland tumors as well as healthy controls (22). Following evaluation of 156 patients with late-onset Alzheimer's disease (AD) and 161 control subjects, Khoram et al reported that CCR532 mutation was uncommon in both AD patients and healthy controls (23). Another study on the Persian race (Shiraz, Iran) showed that CCR532 mutation was not associated with Behcet's disease (BD) compared to a large healthy control population (24). This study reported that CCR532 (380 cases) mutant allele rate was significantly higher in female patients
Mostrar mais

5 Ler mais

32 Mutation in Human Immunodeficiency Virus (HIV)-seropositive and HIV- exposed Seronegative Individuals and in General Population of Medellin, Colombia

32 Mutation in Human Immunodeficiency Virus (HIV)-seropositive and HIV- exposed Seronegative Individuals and in General Population of Medellin, Colombia

Repeated exposure to human immunodeficiency virus (HIV) does not always result in seroconversion. Modifications in coreceptors for HIV entrance to target cells are one of the factors that block the infec- tion. We studied the frequency of32 mutation in ccr5 gene in Medellin, Colombia. Two hundred and eighteen individuals distributed in three different groups were analyzed for ∆ 32 mutation in ccr5 gene by polymerase chain reaction (PCR): 29 HIV seropositive (SP), 39 exposed seronegative (ESN) and 150 individuals as a general population sample (GPS). The frequency of the32 mutant allele was 3.8% for ESN, 2.7% for GPS and 1.7% for SP. Only one homozygous mutant genotype ( ∆ 32/ ∆ 32) was found among the ESN (2.6%). The heterozygous genotype (ccr5/ ∆ 32) was found in eight GPS (5.3%), in one SP (3.4%) and in one ESN (2.6%). The differences in the allelic and genotypic frequencies among the three groups were not statistically significant. A comparison between the expected and the observed genotypic frequencies showed that these frequencies were significantly different for the ESN group, which indirectly suggests a protective effect of the mutant genotype (∆32/∆32). Since this mutant geno- type explained the resistance of infection in only one of our ESN persons, different mechanisms of pro- tection must be playing a more important role in this population.
Mostrar mais

6 Ler mais

Frequency of polymorphisms of genes coding for HIV-1 co-receptors CCR5 and CCR2 in a Brazilian population

Frequency of polymorphisms of genes coding for HIV-1 co-receptors CCR5 and CCR2 in a Brazilian population

32 allele [14,19,20]. However, identification of the heterozygous condition for CCR5 accounts for only a small proportion of the long-term non-progressors that remain AIDS-free for 10 to 20 years after HIV-1 infection. As an example, more than 60% of long-term non-progressors are homozygous for the common allele CCR5+/+ [13]. The other chemokine receptor gene, CCR2, also has some degree of polymorphism that might be related to disease progression. A point mutation, CCR2 64I, occurs at an allele frequency of 10 to 15% among Caucasians and African Americans. Data from one large cohort indicate that HIV-1 infected individuals carrying this allele progressed to AIDS two to four years later than individuals homozygous for the common allele [14], whereas another study failed to detect this association [18].
Mostrar mais

5 Ler mais

Immunodeficiency Virus (HIV) seropositive Subjects and seronegative Individuals from the State of Pará in Brazilian Amazonia

Immunodeficiency Virus (HIV) seropositive Subjects and seronegative Individuals from the State of Pará in Brazilian Amazonia

isoleucine at position 64 of the CCR2 protein. Mellado et al. (1999) indicated that the CCR2-64I protein can prefer- entially dimerize with CXCR4 polypeptides (the HIV-1 re- ceptor that replaces CCR5 as an entry receptor at later stages), whereas the wild-type CCR2 peptides do not. Thus, this mechanism suggests that CCR2-64I delays AIDS by limiting the transition from CCR5 to CXCR4 in infected in- dividuals, a turning point in the collapse of the CD4-T lym- phocyte cell population and a prelude to AIDS-defining disease (Berger et al., 1999). The CCR2-64I allele has been found at relatively high average frequencies in almost all populations studied to date, i.e.: European, 13%; African, 17%, Asian 13% (Su et al., 1999, 2000; Martinson et al., 2000. A previous study performed on a sample of the gen- eral population of the northern Brazilian city of Belém, the capital of the state of Pará, population around 1,4 million (Brazilian Institute of Geography and Statistics - IBGE, 2004) in the Brazilian Amazon revealed the presence of the CCR2-64I mutation at a frequency of 0.161 (Carvalhaes et al., 2004) but higher frequencies have been found in Afro-Brazilians (0.230), whereas in Brazilian Amerindians the frequency of this mutation varies from 0.030 to 0.300 (Su et al, 1999; Acosta et al., 2003; Carvalhaes et al., 2004).
Mostrar mais

5 Ler mais

Triosephosphate isomerase gene promoter variation: -5GA and -8GA polymorphisms in clinical malaria groups in two African populations

Triosephosphate isomerase gene promoter variation: -5GA and -8GA polymorphisms in clinical malaria groups in two African populations

Mutations age for the single nucleotide variants -5G>A and -8G>A was estimated based on the expected STR mutation rate and decay of LD due to recombination between a STR polymorphic marker and the single nucleotide locus over the generations. Haplotype frequencies for the two microsatellites CD4 and ATN1 located respectively 70 Kb and 79 Kb downstream and upstream the TPI1 gene were considered. For the -5 locus the -5G was considered as the ancestral allele because it was the most common allele found in non-human primates (chimpanzee) (http://www.ensembl.org) (Humphries et al. 1999). Estimates of mutation age for the TPI1 promoter variants, -5G>A and -8G>A, based on CD4 and ATN1 microsatellites are depicted in Table 5. The -8G>A mutation age was estimated on two possible backgrounds, -5G and -5A. Results based on CD4 molecular marker show more ancient ages than those calculated from ATN1 locus.
Mostrar mais

18 Ler mais

CCR5 genotypes and progression to HIV disease in perinatally infected children

CCR5 genotypes and progression to HIV disease in perinatally infected children

The CCR5 molecule, a chemokine receptor, is the most important co-receptor for macrophage-tropic HIV-1. A 32-bp deletion in the gene encoding CCR5 (CCR5-del32) confers nearly complete resistance to HIV-1 infection in homozygotes, and slows the rate of progression to AIDS in heterozygous adults. The aim of this study was to describe the CCR5 genotypes and the characteristics of HIV disease progression in perinatally infected children. From a total of 51 children analyzed for the CCR5-del32 mutation, 18 (35%) were considered to be rapid progressors, 28 (55%) were moderate progressors and 5 (10%) were slow progressors. A portion of the CCR5 gene was amplified by PCR from genomic DNA followed by agarose gel electrophoresis. Forty-nine children (96%) carried the homozygous wild type genotype for CCR5 while 2 (4%) carried the heterozygous wt/del32 genotype. In the population studied, the CCR5 genotype was unable to account for the differences in pattern of the disease progression among the three groups (rapid, moderate and slow progressors), and the allele frequency of CCR5-del32 was too low to allow statistical comparisons with adequate resolving power. Studies on larger populations may help to further elucidate the role of this allele and other host factors in the regulation of HIV-1 pathogenesis in children.
Mostrar mais

3 Ler mais

The effect of combined polymorphisms in chemokines and chemokine receptors on the clinical course of HIV-1 infection in a Brazilian population

The effect of combined polymorphisms in chemokines and chemokine receptors on the clinical course of HIV-1 infection in a Brazilian population

Molecular analyses - Genomic DNA was extracted from patient whole blood samples using the GFX Ge- nomic Blood Purification™ kit (Amersham Bioscienc- es, Piscataway, NJ, USA). Genotyping of the CCR5 coding region (rs333) was performed using polymer- ase chain reaction (PCR), while genotyping of CCR2 (rs1799864), the CCR5 promoter (rs1799987) and SDF1 (rs1801157) were performed using PCR followed by restriction fragment length polymorphism (PCR-RFLP). PCR reactions were conducted in a final volume of 25 µL consisting of 5 pmol of each primer, 0.3 mM dNTP, 2.5 mM MgCl 2 , 0.75 U of Taq polymerase (In- vitrogen Corporation, San Diego, CA), 20 mM Tris-HCl (pH 8.4), 50 mM KCl and approximately 0.5 ug of ge- approximately 0.5 ug of ge- nomic DNA. For the CCR5 coding region, the primers 5’CAAAAAGAAGGTCTTCATTACACC3’ (forward) and 5’CCTGTGCCTCTTCTCATTTCG3’ (reverse) were used as previously described (Huang et al. 1996). For the wild type allele, the amplified product was 189 bp long, while for the CCR5-∆32 allele, it was 157 bp long. PCR fragments were electrophoresed in a 2% agarose gel. For CCR2 PCR amplification, the primers 5’GGATTGAACAAGGACGCATTTCCCC3’ (forward) and 5’TTGCACATTGCATTCCCAAAGACCC3’ (re- verse) were used as described previously (Magierowska et al. 1999). The 380 bp products were subjected to RFLP with the restriction enzyme BseGI, generating two frag- ments (215 and 165 bp) only when the mutation corre- sponding to CCR2-64I was present. The wild type allele remained uncut (Suresh et al. 2006). For the CCR5 promot- er region, primers 5’AAAATCCCCACTAAGATCCTG3’ and 5’ATTCATCTAGTCAAAAGCCCAC3’ were used (An et al. 2000). The final product of 394 bp was di- gested with Bsp 1286 I, generating two (329 and 65 bp) or three (202, 127 and 65 bp) fragments for the alleles CCR5-59029A or CCR5-59029G, respectively. Finally, for the amplification of SDF-1 gene, the primers 5’- CAGTCAACCTGGGCAAAGCC-3’ and 5’-CCTGA- GAGTCCTTTTGCGGG-3’ were used (Winkler et al. 1998). The 293 bp PCR product was subjected to RFLP with MspI. The digestion of the common SDF-1 allele produced two DNA fragments (100 and 193 bp), while the SDF1-3’A remained intact (Winkler et al. 1998).
Mostrar mais

9 Ler mais

CCR2 and CCR5 genes polymorphisms in women with cervical lesions from Pernambuco, Northeast Region of Brazil: a case-control study

CCR2 and CCR5 genes polymorphisms in women with cervical lesions from Pernambuco, Northeast Region of Brazil: a case-control study

Chemokine receptor (CCR)5 is the major receptor for the chemokine and their ligands are the macrophage in- flammatory protein (MIP)-1α/chemokine ligand (CCL)3, MIP-1β/CCL4, and regulated on activation, normal T cell expressed and secreted/CCL5 (Lehner 2002, Al-Abdul- hadi & Al-Rabia 2010, Ahmadabadi et al. 2012). Polymor- phic variations in this gene, in particular the Δ32 mutation (a 32 bp deletion in the CCR5 gene) leads to decreased ex- pression and dysfunction of CCR5 receptor (Nahon et al. 2008, Ahmadabadi et al. 2012). Studies report that indi- viduals homozygotes for CCR5-Δ32 (rs333) gene have re- duced risk for asthma and early-onset myocardial infarc- tion, attenuation of severity in rheumatoid arthritis, and slower acquired immune deficiency syndrome (AIDS) progression (Berger et al. 1999, Hall et al. 1999, Zapico et al. 2000, González et al. 2001). In addition CCR5, to- gether with CCR2, act as co-receptors for human immu- nodeficiency virus-1 (Zheng et al. 2006).
Mostrar mais

7 Ler mais

Genetic diversity and prevalence of CCR2-CCR5 gene polymorphisms

Genetic diversity and prevalence of CCR2-CCR5 gene polymorphisms

Historically, Oman played a central role as a gateway for the spice and frankincense trade that linked Yemen and India to Africa and Eurasian regions. Consequently, the hu- man population of this region of the Middle East is ex- pected to display a high degree of diversity that reflects its cosmopolitan past (Cinnioglu et al., 2004; Semino et al., 2004; Al-Abri et al., 2012). This suggests that a high degree of diversity is likely to be found in the CCR2-CCR5 genes in the Omani population. Although a few studies have ex- amined the frequency of CCR5D32 in the Arabian Penin- sula (Salem et al., 2009; Voevodin et al., 1999), no studies have investigated the allele frequencies of other polymor- phisms and the gene diversity of the CCR2-CCR5 complex in this region. In this study, we examined the frequency of the variable sites (the cis-regulatory and coding regions) of the CCR5 gene and estimated the allele frequency of the V64I mutation in the CCR2 gene in the Omani population. We also explored the genetic diversity based on the CCR2- CCR5 gene locus in the Omani population and compared it with other populations.
Mostrar mais

8 Ler mais

The case for selection at CCR5-Delta32.

The case for selection at CCR5-Delta32.

The first suggestion that CCR5 may have been subject to positive selection was a high proportion of nonsynonymous mutations at CCR5, suggesting selective pressure for amino acid divergence [12]. More compelling evidence for selection on CCR5-D32 came from work by Stephens et al. [8]. This study found that D32 occurs at high frequency in European Caucasians (5%–14%, with north-south and east-west clines) but is absent among African, Native American, and East Asian populations, suggesting that the D32 mutation occurred after the separation of the ancestral founders of these populations. Moreover, Stephens et al. [8] reported strong LD between CCR5-D32 and two microsatellite markers, suggesting an estimated age for the allele of only ;700 y (range 275–1,875 y). The apparent rapid rise in frequency implied strong positive selection, and the specific age raised intriguing possibilities for the selective agent, such as the bubonic plague in Medieval Europe.
Mostrar mais

7 Ler mais

Frequency of CCR5 ∆∆∆∆∆32 in Brazilian populations

Frequency of CCR5 ∆∆∆∆∆32 in Brazilian populations

brown, and yellow + Amerindian individu- als, respectively (7). More recently, the ex- pression Afro-descendent has been incorpo- rated into this ethnic semantic definition (8). However, the last investigators have esti- mated that about 148 million Brazilians pres- ent more than 10% of African nuclear ge- nome ancestry, and that at least 89 millions of individuals have mtDNA lineages of Af- rican origin (8). This illustrates the exten- sion of admixture in Brazil and supports the suggestion that skin color and other pheno- typic traits can be poor predictors of genom- ic ancestry. These results reinforce the idea that, independently of the chosen criteria, it is problematic to classify people. To facili- tate reading and comprehension, the word “black” will be used here to refer to any person (or population) identified and/or self- identified with some term that reports Afri- can ancestry according to physical appear- ance, whereas “white” will be used to define those that, according to their physical traits,
Mostrar mais

5 Ler mais

Frequency of the CCR5-A32 mutation in the Atlantic island populations of Madeira, the Azores, Cabo Verde, and São Tomé e Príncipe

Frequency of the CCR5-A32 mutation in the Atlantic island populations of Madeira, the Azores, Cabo Verde, and São Tomé e Príncipe

Allele frequencies of the CCR5-A32 mutation from the Atlantic islands of Madeira, the Azores, Cabo Verde (subdivided into north and south groups), and Sào Tomé e Pr[r]

8 Ler mais

Chemokines and chemokine receptors expression in the lesions of patients with American cutaneous leishmaniasis

Chemokines and chemokine receptors expression in the lesions of patients with American cutaneous leishmaniasis

T cells to peripheral tissue is mediated by a combina- tion of adhesion molecules and chemokine receptors (Laudanna et al. 2002). It is also known that cytokines are directly involved in chemokine production and may precede the expression of chemokines (Ohmori et al. 1993). In fact, interleukin (IL)-12 is required for the in- duction of Th1-related chemokines such as XCL1 (also known as lymphotactin), CXCL10 [induced protein-10 (IP-10)] and CCL2 [monocyte chemoattractant protein (MCP)1] (Zaph & Scott 2003) and interferon (IFN)-γ selectively induces CXCL10 and CXCL9 (monokine in- duced by IFN-γ) (Farber 1997). Other chemokines, such as CXCL5 (RANTES) and CCL11 (eotaxin), have been associated with a Th2 response. Although chemokine receptors are not exclusively expressed on specific T cell subsets (Kim et al. 2001), CXCR3 appears to be ex- pressed by most Th1 cells, whereas CCR3 is expressed primarily by Th2 cells (Bonecchi et al. 1998, Sebas- tiani et al. 2001).
Mostrar mais

7 Ler mais

The comparison of the structure and microhardness of the tool steel C90 and HS 6-5-2 remelted with the electric arc

The comparison of the structure and microhardness of the tool steel C90 and HS 6-5-2 remelted with the electric arc

The tool steels consistute a very important group of materials used for the production, not only tools, but also machine ele- ments, that need to have the increased strength, for example the high-speed steels are used on the rolling bearing operating in high temperatures [1]. Modern technologies such as: laser treatment, electron treatment, CVD, PVD methods, give the possibility of forming the structure of the surface layer of steels providing the demaded properties. The economic factors direct research in using the plasma of the electric arc for shaping the surface layer of the machine elements and tools. Advantages of that method are the possibilities of receiving wider treated areas with one stream of the heat in comparison with the laser technologies or electron
Mostrar mais

4 Ler mais

The Impact of E-Commerce Securi ty, and National Environment  on Consumer adoption of Intern et Banking in Malaysia and  Singapore

The Impact of E-Commerce Securi ty, and National Environment on Consumer adoption of Intern et Banking in Malaysia and Singapore

views an innovation as offering an advantage over previous ways of performing the same task (Roger, 1983; Agarwal & Prasad, 1997). Internet experience and banking need is defined as the degree to which an innovation is viewed as being consistent with the existing values, needs and experiences of a user (Rogers, 1983; Taylor & Todd, 1995). Trialability is the extent to which users would like an opportunity to experiment with an innovation prior to committing to its usage (Roger, 1983; Agarwal & Prasad, 1997). Subjective norm refers to a person’s perception that most people who are important to him or her think he or she should or should not perform the behavior in question (Fishbein & Ajzen, 1975; Tan & Teo, 2000). Self-efficacy is defined as an individual’s self-confidence in his or her ability to perform a behavior (Bandura, 1982; Taylor & Todd, 1995). While, facilitating condition refers to the easy access of technological resources and infrastructure. Government support is consistent with the national systems of innovation theory that posits that government policies may encourage or mandate technology development and adoption (King et. al., 1994; Wolcott et. al., 2001).
Mostrar mais

20 Ler mais

Increased frequency of circulating CCR5+ CD4+ T cells in human immunodeficiency virus type 2 infection

Increased frequency of circulating CCR5+ CD4+ T cells in human immunodeficiency virus type 2 infection

On the other hand, despite differing levels of viremia, we did not find significant differences between HIV-2 and HIV-1 pro- viral DNA levels, suggesting the presence of similar numbers of infected cells in the two infection categories (Table 1), in agreement with previous reports (3–5, 14, 31). Proviral DNA was assessed by absolute quantitative real-time PCR using an ABI PRISM 7000 sequence detection system (Applied Biosys- tems) with a detection range of 7 orders of magnitude and a sensitivity of five copies. Reactions containing 150 ng of genomic DNA extracted from 10 6 PBMC by use of an ABI
Mostrar mais

5 Ler mais

The Existence Of Leading Islands Securing And The Border Areas Unitary State Of Indonesia An Analysis In Law Perspective

The Existence Of Leading Islands Securing And The Border Areas Unitary State Of Indonesia An Analysis In Law Perspective

Abstract: The research was carried with the aim to discover the existence of securing the foremost islands and state border region of the Republic of Indonesia reviewed from a legal perspective, which is directly related to the existence of security and dispute resolution methods as well as the governance of the foremost islands and border region in Kalimantan which bordering Malaysia. This study was conducted in Nunukan district and the surrounding provinces of Kalimantan, in this research method that used is normative legal analysis data with juridical and qualitative descriptive approach. The results showed that the security of foremost islands and border region of law perspective in accordance with the Law No. 34 of 2004 regarding the Indonesian National Army has not been implemented to the fullest to realize the security of foremost islands and border region as the frontline of the Republic of Indonesia. The existence of leading islands securing and the border region of the Republic of Indonesia still contain many weaknesses in terms of both governance and security.
Mostrar mais

4 Ler mais

An Analysis Of The Difference In Gender Level Of Cassava Production And Access To Land In Abia State Nigeria

An Analysis Of The Difference In Gender Level Of Cassava Production And Access To Land In Abia State Nigeria

Women also provide most of the labour for harvesting and post-harvest activities (FAO, 1996). Cassava is important, not only as a food crop but even more as a major source of income for rural households (Davies et al., 2008). As a cash crop, cassava generates cash income for the largest number of households in comparison with other staples. However the sustainability of this staple crop depends on the enormous availability of land for its cultivation. Land is the foundation of all human, social and economic activities that lie at the heart of social, political, or economic life of most nations especially African nations. Land is recognized as a primary source of wealth, social status and power, the basis for shelter, food, and economic activities and significantly provides employment opportunities in the rural areas. Land is fundamental to agriculture, yet the different challenges women face in accessing them are rarely fully addressed. For women, it is often particularly difficult to access, own or control land due to legal or cultural restrictions ( Emeasoba, 2012). This problem is widespread; women hold title to approximately two percent of land globally and are frequently denied the right to inherit property (World Bank, 2005). The wealth obtainable from cassava production, processing and marketing as a result of gender inequality remains under serious threat if nothing is done to improve the operating environmental and socio- economic conditions of the farmers in terms of asset holding, welfare and credit availability. The broad objective of the study is to analyze male and female access to land for cassava production in Abia state and specifically to describe the socio-economic characteristics of the respondents and the difference in quantity of cassava produced by both male and female respondents.
Mostrar mais

5 Ler mais

ISSN 0100-879X BIOMEDICAL SCIENCES AND CLINICAL INVESTIGATION

ISSN 0100-879X BIOMEDICAL SCIENCES AND CLINICAL INVESTIGATION

Leprosy is caused by Mycobacterium leprae, which induces chronic granulomatous infection of the skin and peripheral nerves. The disease ranges from the tuberculoid to the lepromatous forms, depending on the cellular immune response of the host. Chemokines are thought to be involved in the immunopathogenesis of leprosy, but few studies have investigated the expression of chemokine receptors on leukocytes of leprosy patients. In the present study, we evaluated 21 leprosy patients (M/F: 16/5) with a new diagnosis from the Dermatology Outpatient Clinic of the University Hospital, Federal University of Minas Gerais. The control group was composed of 20 healthy members (M/F: 15/5) of the community recruited by means of announcements. The expression of CCR2, CCR3, CCR5, and CXCR4 was investigated by flow cytometry on the surface of peripheral blood lymphocytes. There was a decrease in percentage of CD3+CXCR4+ and CD4+CXCR4+ lymphocytes in the peripheral blood of leprosy patients (median [range], 17.6 [2.7-41.9] and 65.3 [3.9-91.9], respectively) compared to the control group (median [range], 43.0 [3.7-61.3] and 77.2 [43.6-93.5], respectively). The percentage of CD4+CXCR4+ was significantly lower in patients with the tuberculoid form (median [range], 45.7 [0.0-83.1]) of the disease, but not in lepromatous patients (median [range], 81.5 [44.9-91.9]). The CXCR4 chemokine receptor may play a role in leprosy immunopathogenesis, probably directing cell migration to tissue lesions in tuberculoid leprosy patients.
Mostrar mais

6 Ler mais

The application of optical measurements for the determination of accuracy of gear wheels casts manufactured in the RT/RP process

The application of optical measurements for the determination of accuracy of gear wheels casts manufactured in the RT/RP process

Rapid prototyping (RP) and rapid tooling (RT) systems are increasingly used in the production of casting components. RP systems can be used directly for manufacturing casting moulds [1- 9]. The spectrum of rapid prototyping uses can be expanded by the application of the rapid tooling methods. One of the RT techniques is the direct manufacture of casting moulds using the ZCast technology. The accuracy of gear wheels casts made in printed moulds depends on a variety of technological factors [10- 13]. The accuracy of the cast fabrication quality can be assessed with the use of the coordinate optical measuring technique [14- 16]. Literature describes the methods for manufacturing moulds in
Mostrar mais

4 Ler mais

Show all 10000 documents...