• Nenhum resultado encontrado

Efeito do cimento de ionomêro de vidro na expressão gênica de S. mutans em diferentes exposições de tempo : Effect of glass ionomer cement on gene expression of S. mutans in different time expositions

N/A
N/A
Protected

Academic year: 2021

Share "Efeito do cimento de ionomêro de vidro na expressão gênica de S. mutans em diferentes exposições de tempo : Effect of glass ionomer cement on gene expression of S. mutans in different time expositions"

Copied!
31
0
0

Texto

(1)

FACULDADE DE ODONTOLOGIA DE PIRACICABA UNIVERSIDADE ESTADUAL DE CAMPINAS

IGOR ALVES DA SILVA

EFEITO DO CIMENTO DE IONOMÊRO DE VIDRO NA

EXPRESSÃO GÊNICA DE S. MUTANS EM DIFERENTES

EXPOSIÇÕES DE TEMPO

EFFECT OF GLASS IONOMER CEMENT ON GENE

EXPRESSION OF S. MUTANS IN DIFFERENT TIME

EXPOSITIONS

PIRACICABA 2016

(2)

EFEITO DO CIMENTO DE IONOMÊRO DE VIDRO NA

EXPRESSÃO GÊNICA DE S. MUTANS EM DIFERENTES

EXPOSIÇÕES DE TEMPO

EFFECT OF GLASS IONOMER CEMENT ON GENE

EXPRESSION OF S. MUTANS IN DIFFERENT TIME

EXPOSITIONS

Dissertação apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas como parte dos requisitos exigidos para obtenção do título de Mestre Materiais Dentários.

Dissertation presented to the Piracicaba Dental School of The University of Campinas in partial fulfillment of the requirements for the degree of Master in Dental Materials.

Orientador: Regina Maria Puppin-Rontani

PIRACICABA 2016

Este exemplar corresponde à versão final da dissertação defendida por IGOR ALVES DA SILVA e orientada pela Profa. Dra.

(3)

Agência(s) de fomento e nº(s) de processo(s): CAPES

Ficha catalográfica Universidade Estadual de Campinas Biblioteca da Faculdade de Odontologia de Piracicaba

Marilene Girello - CRB 8/6159

Silva, Igor Alves da, 1990-

Si38e Efeito do cimento de ionomêro de vidro na expressão gênica de S. mutans em diferentes exposições de tempo / Igor Alves da Silva. – Piracicaba, SP : [s.n.], 2016.

Orientador: Regina Maria Puppin Rontani.

Dissertação (mestrado) – Universidade Estadual de Campinas, Faculdade de Odontologia de Piracicaba.

1. Cimentos de ionômeros de vidro. 2. Streptococcus mutans. I. Puppin- Rontani, Regina Maria,1959-. II. Universidade Estadual de Campinas. Faculdade de Odontologia de Piracicaba. III. Título.

Informações para Biblioteca Digital

Título em outro idioma: Effect of glass ionomer cement on gene expression of S. mutans in

different time expositions

Palavras-chave em inglês:

Glass ionomer cements

Streptococcus mutans

Área de concentração: Materiais Dentários

Titulação: Mestre em Materiais Dentários Banca examinadora:

Regina Maria Puppin Rontani [Orientador] Rafael Pino Vitti

Janaina de Cassia Orlandi Sardi

Data de defesa: 22-02-2016

(4)
(5)

RESUMO

O objetivo neste estudo foi avaliar o efeito do cimento de ionômero em contato com biofilme de S. mutans, sobre a expressão dos genes gtfC, gtfD, covR e vicR, em diferentes exposições de tempo de 2h, 4h e 24 h. Foram confeccionados discos de cimento de ionômero de vidro e cerâmica (controle) de dimensões 10 x 2 mm, distribuídos em 6 grupos de acordo com o tempo de contato e material restaurador (n=5): material (Cimento de ionômero de vidro- KetacTM Molar Easymix (3M ESPE) e IPS Empress 2 (Ivoclar Vivadent, Schaan, Liechtenstein) e tempo (2h,4h e 24h). Os discos de ionômero de vidro foram manipulados em uma câmara de fluxo de ar, sob condições assépticas, por um único operador de acordo com as especificações do fabricante. Após 24 horas em armazenamento com 100% de umidade relativa a 37°C, os discos foram colocados em uma placa com 24 poços com o inocúlo de S. mutans no BHI + 1% de sacarose e o crescimento do biofilme ocorreu nos tempos de 2h,4h e 24h. Após a coleta do biofilme, o mesmo foi armazenado a −80°C. Em seguida, ocorreu a purificação do RNA usando o protocolo RNeasy Mini Kit (Qiagen) e a reação de transcriptase reversa foi realizada utilizando 1 µg RNA, usando o iScript cDNA Synthesis (BioRad) de acordo com as recomendações do fabricante. Os dados foram submetidos a ANOVA um fator, Kruskal-Wallis e Tukey testes, considerando o nível de significância de α=0,05, usando o programa Biostat 5.0. Não foi observada diferença significativa na expressão dos genes avaliados tanto para 2h quanto para 4h para ambos os materiais. No entanto, observou-se diminuição significativa para o tempo de 24h na expressão nos genes gtfC, vicR e covR comparado ao grupo controle (cerâmica). Conclui-se que: o cimento de ionômero de vidro teve influência na expressão gênica de S. mutans referentes aos genes gtfC, vicR e covR.

(6)

The aim of this in vitro study was to evaluate the effect of different materials (cement glass and ceramic ionomer) in contact with biofilm S. mutans on the expression of gtfC, gtfD, covR and vicR genes in 2h, 4h and 24h time intervals. Discs were manufactured of glass ionomer cement and ceramics (control) mensured 10 x 2 mm, divided into six groups according to the time of contact and restorative material (n = 5): materials (glass-ionomer cement KetacTM Molar Easymix (3M ESPE) and IPS Empress 2 (Ivoclar Vivadent, Schaan, Liechtenstein) and time (2h, 4h and 24h). The glass ionomer cement discs were handled in an air flow cabinet under aseptic conditions, by a single operator according to the manufacturer's specifications. After 24 hours storage at 100% relative humidity at 37 ° C the discs were placed in a 24 well plate with the inoculum of S. mutans BHI + 1% sucrose and biofilm growth occurred in the time of 2h, 4h and 24h. After collection of the biofilm, it was stored at -80 °C. Then, there was the purification of the RNA using the RNeasy Mini Kit protocol (Qiagen) and the reverse transcriptase reaction was performed using 1 ug RNA using the iScript cDNA Synthesis (BioRad) according to the manufacturer's recommendations. Data were analyzed by ANOVA one-way, Kruskal-Wallis and Tukey tests considering the significance level of α = 0.05, using the Biostat 5.0. There was no significant difference 2h and 4h to both materials, for all genes analyzed. However, there was significant decrease in the expression in gtfC, vicR and covR genes when GIC was compared to the control group (ceramics) for 24h. Within the conditions of the present study, glass ionomer cement have influenced the gene expression of S. mutans genes related to gtfC, vicR and covR.

(7)

SUMÁRIO

1 INTRODUÇÃO 8

2 ARTIGO: Effect of glass ionomer cement on gene expression of S. mutans in different time expositions

12

3 CONCLUSÃO 23

REFERÊNCIAS 24

(8)

1 INTRODUÇÃO

Streptococcus mutans é um dos principais patógenos envolvidos no desenvolvimento da cárie dentária (Loesche, 1986), pois possui um grupo de fatores de virulência que lhe confere a capacidade de se acumular no biofilme dentário na presença de sacarose (Hamada et al., 1981) e de produzir e tolerar ácidos resultantes do seu metabolismo (Hirose et al., 1993), os quais resultam na desmineralização do esmalte dentário.

O acúmulo e a colonização de S. mutans no biofilme dentário são dependentes da sua capacidade de sintetizar uma matriz extracelular de glucanos, principalmente insolúveis em água (Hamada et al., 1981). Esses polissacarídeos extracelulares (PECs) são sintetizados a partir da sacarose ingerida na dieta por enzimas extracelulares livres ou associadas à célula bacteriana, denominadas glucosiltransferases (Gtfs). Foram identificadas a ação de pelo menos três enzimas Gtfs em S. mutans – GtfB,GtfC e GtfD, as quais são codificadas pelos genes gtfB, gtfC e gtfD, respectivamente. As atividades de cada Gtf são distinguidas pelo tipo de ligação glicosídica predominante no glucano sintetizado. A GtfB catalisa a síntese de glucanos ricos em ligações glicosídicas do tipo α -1-3 (Aoki et al., 1986), que resultam em polímeros insolúveis em água; GtfC está envolvida na síntese de glucanos solúveis e insolúveis em água e GtfD catalisa a formação de glucanos ricos em ligações glicosídicas α -1-6, que resultam em moléculas solúveis em água (Hanada &Kuramitsu, 1989).

Os PECs aumentam a porosidade do biofilme dental e a difusão de substrato para superfície do esmalte causando um aumento na queda acentuada do pH na interface biofilme-dente (Zero et al., 1986), o que irá resultar em um aumento de espécies acidúricas e acidogênicas (Marsh, 2003). Sendo assim, os PECs aumentam a cariogenicidade do biofilme, sendo considerados um dos principais fatores de virulência.

Outro fator importante para a adaptação, sobrevivência e a virulência bacteriana são os sistemas de dois componentes (TCS, de Two Component System)

(9)

9

(Mitchell et al., 2003; Qi et al., 2004; Senadheera et al., 2005; Biswas & Biswas, 2006) responsáveis pela ativação ou supressão de genes ou grupos de genes necessários para o desenvolvimento em biofilme, tanto de S. mutans como de algumas outras espécies do gênero Streptococcus, em resposta às modificações das condições ambientais. Análises do genoma da cepa S. mutans UA159 revelaram 14 prováveis TCS (Ajdic et al., 2002, Biswas et al., 2008), incluindo VicRK e cinco prováveis reguladores de resposta órfãos, dentre os quais está CovR (Idone et al.,2003). O regulador CovR (de Control of Virulence) já é conhecido por controlar negativamente a expressão de fatores de virulência como glicosiltransferases B, C e D, necessárias para o pleno crescimento em biofilme, e de proteína ligadora de glucano C, importante para agregação de microrganismos dependentes de glucano e formação de biofilmes, (Idone et al., 2003, Biswas & Biswas, 2006). E o regulador VicRK (de Virulence Control) controla positivamente a expressão de fatores de virulência como GtfB, GtfC, GtfD e GbpB (Senadheera et al.,2007).

No ambiente bucal, o biofilme dental apresenta habilidade de colonizar materiais restauradores (Kawai & Urano, 2001; Steinberg & Eyal, 2002; Eick et al., 2004; de Fúcio et al., 2008, 2009; Brentel et al., 2010). Sugere-se que a quantidade de biofilme e seu potencial cariogênico dependem, entre outros fatores, das características de superfície desses materiais (Moura et al., 2004). De maneira geral, o biofilme se forma a partir do contato de uma superfície sólida em contato com um líquido e o tipo , quantidade e qualidade do biofilme formado apresenta relação com as propriedades de superfície desse sólido. Assim, o amálgama de prata apresenta discreta alteração de superfície devido à lixiviação de seus componentes, principalmente o zinco, que atuariam inibindo o desenvolvimento do biofilme (Morrier et al., 1998; Auschill et al., 2002). Estudos anteriores mostraram que produtos biodegradados da resina composta, especialmente o TEGDMA, aumentou o crescimento bacteriano através da liberação do trietilenoglicol (TEG) .Além disso, outro estudo relatou a influência do TEG em relação a expressão gênica do S. mutans, principalmente nos genes gtfB e yfiV, onde houve alterações na expressão da bactéria (Khalichi et al., 2004).

(10)

Os cimentos de ionômero de vidro, por sua vez, possuem a capacidade de interferir com os mecanismos físico-químicos de perda mineral tanto em esmalte como em dentina (Gilmour et ai., 1997; Nagamine et ai., 1997; Dionysopoulos et ai., 1998). Além de interferir na dinâmica do processo de cárie, o cimento de ionômero de vidro também apresenta ação antibacteriana, podendo atuar na ecologia em biofilmes adjacente às restaurações (Benelli et al., 1993). Estudos in vitro mostraram o desenvolvimento de biofilmes menos espessos em contato com o cimento de ionômero de vidro, em comparação com outros materiais, associados a aspectos de erosão na superfície desse material, provavelmente devido a maior liberação de íons como flúor e alumínio, que poderia influenciar o metabolismo bacteriano (Fúcio et al.,2008; Pandit et al., 2011).

Tem sido atribuído a ação do flúor liberado dos materiais, como os CIVs, a atuação sobre a ATPase, que tem importância na homeostase intracelular, uma vez que é responsável pelo bombeamento de prótons para fora da célula. Outro mecanismo de ação do flúor pode ser em relação a inibição da enolase, uma enzima da via glicolítica, o que resulta na diminuição da produção ácida a partir da glicólise (Hüther, F J et al.,1990). O flúor liberado do cimento de ionômero de vidro, na forma de NaF se dissocia em Na+ e F- imediatamente em pH neutro, quando ocorre a diminuição do pH no meio, o F- recebe um próton H+ formando um componente não dissociado de HF. Ressaltando que o HF é mais permeável do que F- para penetrar na membrana celular da bactéria, em pH ácido ocorre uma maior formação de HF, que irá penetrar mais facilmente no interior da célula e se dissociar em F- e H+ em pH relativamente alcalino e essa liberação de H+ também resulta na acidificação intracelular diminuindo a totalidade da atividade glicolítica. O alumínio, por sua vez, parece aprimorar de forma sinérgica o efeito inibitório do flúor sobre a ATPase isolada de S mutans, envolvendo a formação do complexo ADP-Al-F3 no sitio catalítico da enzima. (Lunardi et al 1988). Estudos de Hayacibara et al (2003), mostraram que a concentração de alumínio liberado do cimento de ionômero de vidro modificado por resina teve influência na acidogenicidade do biofilme S. mutans, em que se observou que o material que mais liberou alumínio teve uma menor variação de

(11)

11

pH ao longo do tempo, e que afetou houve uma alteração na formação e composição do biofilme. Tendo em vista que, na literatura atual não se encontram estudos que avaliam se o flúor e o alumínio liberados do CIV interferem na expressão gênica de gtfC, gtfD, covR e vicR.

A hipótese deste estudo é que o CIV em contato com biofilme de S. mutans, afeta a expressão gênica de gtfC, gtfD, covR e vicR, nos tempos de 2h,4h e 24h.

Assim, o objetivo desse estudo foi analisar a expressão dos genes gtfC, gtfD, covR e vicR de S. mutans em contato com o ionômero de vidro em diferentes tempos (2h,4h e 24 h).

(12)

2 ARTIGO

EFFECT OF GLASS IONOMER CEMENT ON GENE EXPRESSION OF

S. mutans IN DIFFERENT TIME EXPOSITIONS

Submetido ao periõdico: Brazilian Dental Journal (Anexo)

Igor Alves da Silva

Regina Maria Puppin Rontani

ABSTRACT

The aim of this in vitro study was to evaluate the effect of glass ionomer cement in contact with biofilm S. mutans on the expression of gtfC, gtfD, covR and vicR genes in 2h, 4h and 24h time intervals. Discs were manufactured of glass ionomer cement and ceramics (control) mensured 10 x 2 mm, divided into six groups according to the time of contact and restorative material (n = 5): materials (glass-ionomer cement KetacTM Molar Easymix (3M ESPE) and IPS Empress 2 (Ivoclar Vivadent, Schaan, Liechtenstein) and time (2h, 4h and 24h). The glass ionomer cement discs were handled in an air flow cabinet under aseptic conditions, by a single operator according to the manufacturer's specifications. After 24h storage at 100% relative humidity at 37 ° C the discs were placed in a 24 well plate with the inoculum of S. mutans BHI + 1% sucrose and biofilm growth occurred in the time of 2h, 4h and 24h. After collection of the biofilm, it was stored at -80 °C. Then, there was the purification of the RNA using the RNeasy Mini Kit protocol (Qiagen) and the reverse transcriptase reaction was performed using 1 ug RNA using the iScript cDNA Synthesis (BioRad) according to the manufacturer's recommendations. Data were analyzed by ANOVA one-way, Kruskal-Wallis and Tukey tests considering the significance level of α = 0.05, using the Biostat 5.0. There was no significant difference 2h and 4h to both materials, for all genes analyzed. However, there was significant decrease in the expression in gtfC, vicR and covR genes when GIC was compared to the control group (ceramics) for 24h. Within the conditions of the present study, glass ionomer cement have influenced the gene expression of S. mutans genes related to gtfC, vicR and covR.

(13)

13

Keywords: Streptococcus mutans, glass ionomer cements, rt-PCR

1 INTRODUCTION

S. mutans plays a major role in biofilm formation and dental caries, since it can effectively use dietary sucrose to form organic acids and to synthesize exopolysaccharides using glucosyltransferases (1). Moreover, its highly acidogenic and aciduric proprieties lead biofilm formation and caries lesion.

Glucosyltransferases (Gtfs) have a major role in virulence of S. mutans. Since the Gtfs are responsible for the production of extracellular polysaccharides that contribute to retention of bacteria to the tooth or restorative materials, and promote bacterial adherence (2) . Extracellular synthesis of glucans occurs by the action of at least three enzymes: gtfB, gtfC and gtfD. The GtfB is responsible for the synthesis of glucans rich in alpha glyosidic linkages of the type 1-3 resulting in water-insoluble polymers. The gtfD is responsible for the formation of water-soluble molecules and the gtfC the synthesis of soluble and insoluble glucans in water.(3)

The up- and down-regulating gene transcription is required for the growth of S. mutans in biofilms, which is under the control of transcriptional regulatory systems of Two Components Signal (TCS) (4). TCS regulates proteins that has a biological function in biofilm formation, essential for bacterial adaptation, survival and virulence. These systems function as “molecular switches” to modulate gene expression in response to changes in the external environment (5).

In S. mutans, genomic analysis showed 14 probable TCS, including VicR and CovR(6). CovR down-regulates expression of glucosyltransferases B, C and D and binding proteins B and C, which participates in glucan-dependent(7). In the other hand, VicR up-regulates gtfB, gtfC, gtfD and gbpB.(8)

The frequent consumption of dietary carbohydrates, mainly sucrose, results in exopolysaccharides formation through the action of

(14)

glucosyltransferases. S. mutans normally expresses three distinct glucosyltransferase (gtfB, gtfC, and gtfD), which polymerizes water-insoluble or –soluble glucans, essential for S. mutans accumulation in biofilm (9).

The chemical composition of the surface of the materials is important for bacterial colonization it is shown the effects of restorative materials on biofilm formation have already been demonstrated in numerous other studies (10–16). However, there are no many work has been done to evaluate the extent to which dental materials can affect the gene expression.

Restorative material properties can dictate the biofilm accumulation and hence development of adjacent caries. Dental materials may have antibacterial properties, due to components releasing, such as cationic ions, which can minimize the deleterious effects of biofilm on restorations. (17)

These materials include metal ions of amalgam alloys, such as Fe²+Zn²+Cu²+(11), fluoride ions and aluminum from glass ionomer cements (18) and by-products of hydrolytic degradation of composites such as TEGDMA (19) .Therefore, certain properties of the material may affect in a greater or lesser degree of biofilm accumulation on the respective substrate(20).

Ionomeric materials have shown anticariogenic and antimicrobial properties (21), which have been basically attributed to their ability to release fluoride over extended periods of time (22).In addition, ionomeric materials release aluminum that inhibit bacterial metabolism and growth, enhancing the biological activities of fluoride (17).

Moreover, the hypotheses of this study is that GIV contacting S. mutans biofilm affects gtfC, gtfD, covR e vicR genes expression, considering 2h, 4h and 24h evaluation.

Then, the present study was carried out to evaluate the gene expression gtfC, gtfD, vicR and covR of S. mutans biofilm growth in contact with the glass ionomer cement considering 2h, 4h and 24h evaluation.

(15)

15

2 MATERIAL AND METHODS

2.1 Specimen Preparation

Glass ionomer cement specimens (Table 1) were fabricated according to the manufacturer’s instructions in sterilized Teflon molds (10 mm in diameter; 2 mm deep) under aseptic conditions. The materials were manipulated, placed in the mold by one operator, covered and pressed flat with a sterilized glass slide, and kept for 5 min until initial set. After this, all disks were removed from the mold and stored in 100% relative humidity at 37°C for 24 hours. Polishing steps were not performed to avoid surface contamination.

The ceramic samples (IPSEmpress esthetic, Ivoclar Vivadent, Schaan -LIE) were prepared by duralay resin disks of 6 mm diameter by 2 mm thick, included in the ceramic coating and then injected into the oven EP 600 (Ivoclar) according to the manufacturer's recommendations. After removed from ceramic coating were ground flat with up to 1200 mm granulation sandpaper for 30 seconds to remove possible residues which have remained on the surface, washed in an ultrasonic bath (Ultrasonic Cleaner,ModelUSC1400,UNIQUE Ind. e Com. Ltda., São Paulo SP 04709-111, Brazil) and autoclaved.

After the confectioned glass ionomer and ceramic samples were placed in petri dishes and maintained in laminar flow hood under UV light for decontamination by 15 minutes for each surface.

(16)

Table 1 Materials used in this study.

Materials Classification Composition

IPS Empress 2 (Ivoclar Vivadent, Schaan, Liechtenstein) Glass ceramic

Powder: 97% SiO2, Al2O3, P2O5, K2O, Na2O, Cao, F and 3 % TiO2 and

pigments.

Liquid: water, alcohol, chloride.

Ketac Molar Easymix (3M ESPE, St. Paul, MN, USA Conventional Glass Ionomer Cement Powder: aluminum-calcium-lanthanum fluorosilicate glass, 5% polycarbonate

acid

Liquid: copolymer of acrylic and maleic acid, tartaric acid, water.

2.2 Biofilm Growth

Streptococcus mutans strain UA159 was growth on Mitis Salivarius Agar (Difco Laboratories) plates at 37˚C for 24 hours at 10% CO2. Colonies were inoculated

into 4 mL of Brain heart infusion (BHI) broth (Difco Laboratories) and incubated in same conditions for 18 h.

Subsequently, the absorbance readings were performed (A550nm) in a spectrophotometer Genesys 2 (Spectronic Unicam, USA). Then it was added in a solution with 1,5 ml BHI sterilized containing 1% sucrose and distributed in a 24-well polystyrene plate (24- wells, Corning, New York, EUA)

The specimens were distributed into 6 groups according to time evaluation and material used as follow: material (ceramic – control group; glass ionomer cement) and time (2h, 4h and 24h) at 37˚C and 10% CO2. Both samples were subjected under

UV light for 15 minutes for each surface before the biofilm growth. Both materials were analyzed by gtfC, gtfD, vicR and covR expression.

(17)

17

2.3 RNA Purification and Reverse Transcription

For RNA purification, the biofilm was transferred to cryogenic tubes with thread and added “beads” with 0.16 g with 0.1 mm diameter Zirconium Beads (Biospec, Bartlesville, OK, EUA) to mechanical disruption on a Mini-beadbeater (Biospec) at maximum power 2 cycles of 30 s at 1 min intervals rest on ice). The following RLT was added with beta-mercapto stirring in vortex for 30 seconds. Centrifugation at 11000g, 4 ° C for 2 minutes was performed and the supernatant was transferred to Eppendorf containing pure ethanol. The resulting solution was transferred to columns (Qiagen's RNeasy on-column DNase I (2.7 U DNase / RNA 10mg) and the extraction process continued with the addition of RW1 and RPE interspersed with centrifugation at 11000g for 30 seconds at room temperature . In order to initiate the degradation of genomic DNA present in the sample RDD and DNAse were placed on the column and incubated for 15 minutes at room temperature. Additional extraction was performed using RW1 and RPE again interspersed with centrifugation at 11000g for 30 seconds at room temperature. The RNA was recovered and suspended in water-free of DNase and RNase (Qiagen) and quantified in spectrophotometer (ABS 260 nm). Subsequently, the crude RNA was treated with another DNAse (Ambion Turbo DNase I, 2 U DNase I / 10mg RNA) incubated at 37 ° C for 30 min followed by the DNase I to remove using Qiagen RNeasy MinElute according to the manufacturer's recommendations. The purity and integrity of the RNA was analyzed on an electrophoresis photo documentor (EI Logic 200 Imaging System) and verification of the absorbance ratio A260 / A280.

To obtain cDNA using the iScript™ was Reverse Transcription Kit for RT-qPCR Supermix (Bio-Rad, Hercules, CA USA) as recommended by manufacturer Biorad, USA.

2.4 Quantitative real-time PCR

The PCR based quantitative real-time was performed using primers specific for genes gtfC, gtfD, vicR, and covR (Table 2). The reactions of Quantitative PCR were performed in the StepOne ™ Real-Time PCR Systems unit (Applied Biosystems, UK). Each well contained 1μl cDNA 9μl each sample and the solution containing free water 3,4μl DNase and RNase, 0.6 l of primer and 5μl of SYBR Green PCR Master Mix (Applied Biosystems). Standard curves (300.30, 3, 0.3, 0.03) for each test were performed with primer pairs. The PCR based quantitative real-time was performed

(18)

using primers specific for genes gtfC, gtfD, vicR and covR (Table 2). Results were normalized against S. mutans 16S rRNA gene expression, which was invariant under experimental conditions. Assays were performed in duplicate with at least five independent RNA samples.

Table 2 - Sequence specific primers for the analyzed genes and gene reference number of base pairs and references.

PRIMERS (qPCR)

Sequence 5´-3´ (Foward/Reverse) Product Size

16SRNA CGGCAAGCTAATCTCTGAAA/GCCCCTAAAAGG TTACCTCA 190 pb (Stipp et al., 2013) SMU.910 (gtfD) TGATTCGTGGTATCGTCCTAA/GTTGAGACTTT CTTGGCTGCT 199 pb (Stipp et al., 2013) SMU.1005 (gtfC)

ACCAACCGCCACTGTTACT/AACGGTTTACCGC TTTTGAT 161 pb (Stipp et al., 2013) SMU.1517 (vicR) AGTGGCTGAGGAAAATGCTT/CATCACCTGACC TGTGTGTG 163 pb (Stipp et al., 2013) SMU.1924 (covR)

ACGAAATATGGCACGAACAC/CAGAGATGGACG GGTATGAA 185 pb (Stipp et al., 2013)

2.5 Statistical Analysis

After data normality has been tested, data obtained from all genes expression provided by materials tested and time were analyzed individually and submitted to one-way ANOVA and Tukey tests, except for covR 24h, which was used Kruskal-Wallis, the significant level was set at alfa=0.05, using the Biostat 5.0 software.

(19)

19

3 RESULTS

Figure 1, 2 and 3 show mean and standard deviation of transcript levels of gene expression of S. mutans contacting GIC and ceramic for 2h, 4h and 24h exposition respectively.

There was no significant difference on transcript levels for all genes expression between GIC and ceramic contacting S. mutans biofilm, considering 2h and 4h. However, there was significant decrease on gtfC, vicR and covR genes expression when compared GIC and control group was compared, considering 24h evaluation.

Similar capital letters means significant statistically difference between the restorative materials for each gene expression.

Fig. 1 Mean and standard deviation of amount gene express of S. mutans in group 2

hours. 0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00

glass ionomer cement ceramic

Tra n scrip t le ve ls

2-h

gtfC gtfD covR vicR A A A A A A A A

(20)

Fig. 2 Mean and standard deviation of amount gene express of S. mutans in group 4

hours.

Fig. 3 Mean and standard deviation of amount gene express of S. mutans in group 24

hours. 0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00

glass ionomer cement ceramic

Tra n scrip t le ve ls

4-h

gtfC gtfD covR vicR A A A A A A A A A B A B B A A A

(21)

21

4 DISCUSSION

Ionomeric materials are composed of fluoride-containing silicate glass and polyalkenoic acids that are set by an acid–base reaction between the components. During the setting reaction, varieties of ionic constituents are released from the GIC, ions such as calcium, aluminum and fluoride(24). The effects of fluoride on oral bacteria and biofilm are well documented by a considerably amount of literature concerning antimicrobial activity (10,17,21,25), however there is not any work in the literature that evaluates the effects of GIC on gene expression in biofilm S. mutans.

Few studies have indicated that the expression of the genes for the exopolysaccharide-synthesizing enzymes of S. mutans is dependent on environmental conditions, including growth rate, pH, carbon source, and whether the organisms are attached to the surfaces.(26,9). Previous studies showed the expression of the ftf , gtfB and gtfC genes in biofilms is strongly influenced by carbohydrate availability, the type of carbohydrate and the environmental pH (27). Also, when S. mutans was growth in steady-state continuous chemostat culture, decrease of the pH from 7 to 6 resulted in about a 50% increase in the expression of the gtfB/C genes.(26).

In this study 1% sucrose was added to the environment in both groups (GIC and Ceramic) for the bacteria to exert a metabolic activity which sucrose provides the formation of stable biofilms by S. mutans. That percent of sucrose is sufficient to produce a thick, confluent biofilm, which was composed of dense microcolonies with small, water-channel-like void areas(28) . Instead of the present study has promoted the same nutrient conditions for all groups, there was no significant difference on genes expression at 2h and 4h contacting of GIC with the 1% sucrose-containing environment.

Therefore, the hypothesis was partially proved, since at 24h evaluation provided a significant decrease in gtfC expression and in it regulators covR and vicR, when S. mutans biofilm contacting GIC.

The bacterial growth-inhibitory potential of glass-ionomers has been demonstrated in many studies (21,24,29–31) and attributed mainly to the release of fluoride (25). Therefore, a possible explanation for that difference between different time-exposition can be related to ions amount released by the GIC. It should be

(22)

considered that between 6h and 24h the fluoride release from GIC increase up to three-fold in the environment (32) and the highest fluoride release from glass ionomer cement occurs after 24h(33). This increased amount of ions released from the GIC might have caused a decrease in the expression of genes gtfC, covR and vicR at time 24h.The mechanisms in which fluoride inhibits bacterial acid production are well-known and include the inhibition of the glycolytic enzyme enolase, the proton-translocating ATPase and the intracellular acidification, negatively affecting bacterial colonization and competition(34). Furthermore, intracellular or plaque-associated enzymes such as acid phosphatase, pyrophosphatase, peroxidase and catalase may be affected by fluoride ions(35).

Previous studies demonstrated that not only the fluoride release on the environment is responsible for inhibited the pH drop, but also amount aluminum released (17). The aluminum released from the glass ionomer cement has a synergistic effect with the fluoride in the acid production by bacteria, since aluminum can enhance the inhibitory activity of fluoride on ATPase from S. mutans(17,36). The possible mechanism of the combined action of fluoride and aluminum to inhibit ATPase may involve the formation of ADP-Al-F3 complex in the catalytic site of this enzyme.(37)

In the present study, we analyzed gtfC, gtfD, vicR and covR expression and it was observed decreased genes expression at 24h contacting GIC for gtfC, vicR and covR. It could be associated with the largest amount of íons released in the environment, due to the extended time contact, as previously mentioned. So, this study suggest that eluted compounds or byproducts from restorative materials can affect gene expression of S. mutans biofilm. However, there was no significant difference for gtfD for all studied period and both materials studied.

Therefore, the use of GIC as a restorative material can be associated with a low virulence biofilm due to fluoride releasing effect associated with the decreasing on gtfC, vicR and covR expression can be reached as demonstrated by this study. Further, studies evolving the relationship between the ions releasing from material and biofilm formation and activity should be accomplished.

(23)

23

5 CONCLUSION

It can be concluded that 24h contacting glass ionomer cement decreased transcript levels of gtfC, vicR and covR expression of S. mutans biofilm

ACKNOWLEGMENTS

The authors thank to CAPES/PROEX/AUXPE #1777/2014 for financial support.

REFERENCES

1. Bowen WH, Koo H. Biology of streptococcus mutans-derived glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms. Caries Res. 2011;45(1):69–86.

2. Rölla G. Why is sucrose so cariogenic? The role of glucosyltransferase and polysaccharides. Scand J Dent Res. 1989;97(2):115–9.

3. Hamada S, Slade HD. Biology, immunology, and cariogenicity of Streptococcus mutans. Microbiol Rev. 1980;44(2):331–84.

4. Senadheera MD, Guggenheim B, Spatafora G a., Huang YCC, Choi J, Hung DCI, et al. A VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and ftf expression, biofilm formation, and genetic competence development. J Bacteriol. 2005;187(12):4064–76.

5. Stock AM, Robinson VL, Goudreau PN. T Wo -C Omponent S Ignal T Ransduction. Reactions . 2000;69:183–215.

6. Biswas I, Drake L, Erkina D, Biswas S. Involvement of sensor kinases in the stress tolerance response of Streptococcus mutans. J Bacteriol. 2008;190(1):68–77.

7. Biswas S, Biswas I. Regulation of the glucosyltransferase (gtfBC) operon by CovR in Streptococcus mutans. J Bacteriol. 2006;188(3):988–98.

8. Stipp RN, Boisvert H, Smith DJ, Höfling JF, Duncan MJ, Mattos-Graner RO. CovR and VicRK Regulate Cell Surface Biogenesis Genes Required for Biofilm Formation in Streptococcus mutans. PLoS One. 2013;8(3).

9. Hudson MC, Curtiss R. Regulation of expression of Streptococcus mutans genes important to virulence. Infect Immun. 1990;58(2):464–70.

(24)

10. Eick S, Glockmann E, Brandl B, Pfister W. Adherence of Streptococcus mutans to various restorative materials in a continuous flow system. J Oral Rehabil. 2004;31(3):278–85.

11. Auschill TM, Arweiler NB, Brecx M, Reich E, Sculean A, Netuschil L. The effect of dental restorative materials on dental biofilm. Eur J Oral Sci. 2002;110(1):48– 53.

12. Montanaro L, Campoccia D, Rizzi S, Donati ME, Breschi L, Prati C, et al. Evaluation of bacterial adhesion of Streptococcus mutans on dental restorative materials. Biomaterials. 2004;25(18):4457–63.

13. Fúcio SBP, Carvalho FG, Sobrinho LC, Sinhoreti M a C, Puppin-Rontani RM. The influence of 30-day-old Streptococcus mutans biofilm on the surface of esthetic restorative materials-An in vitro study. J Dent. 2008;36(10):833–9. 14. Willershausen B, Callaway a, Ernst CP, Stender E. The influence of oral bacteria

on the surfaces of resin-based dental restorative materials--an in vitro study. Int Dent J. 1999;49(4):231–9.

15. Singh J, Khalichi P, Cvitkovitch DG, Santerre JP. Composite resin degradation products from BisGMA monomer modulate the expression of genes associated with biofilm formation and other virulence factors in Streptococcus mutans. J Biomed Mater Res - Part A. 2009;88(2):551–60.

16. Khalichi P, Cvitkovitch DG, Santerre JP. Effect of composite resin biodegradation products on oral streptococcal growth. Biomaterials. 2004;25(24):5467–72.

17. Hayacibara MF, Rosa OPS, Koo H, Torres S a, Costa B, Cury J a. Effects of fluoride and aluminum from ionomeric materials on S. mutans biofilm. J Dent Res. 2003;82(4):267–71.

18. Nakajo K, Imazato S, Takahashi Y, Kiba W, Ebisu S, Takahashi N. Fluoride released from glass-ionomer cement is responsible to inhibit the acid production of caries-related oral streptococci. Dent Mater. 2009;25(6):703–8.

19. Khalichi P, Singh J, Cvitkovitch DG, Santerre JP. The influence of triethylene glycol derived from dental composite resins on the regulation of Streptococcus mutans gene expression. Biomaterials. Elsevier Ltd; 2009;30(4):452–9.

20. Suljak JP, Reidt G, Wood SM, Mcconnell RJ, Meis HC Van Der, Busscherts HJ. Bacterial adhesion to dental three resin composites amalgam. 1995;23(3):171– 6.

21. Benelli EM, Serra MC, Rodrigues AL, Cury JA. In situ anticariogenic potential of glass ionomer cement. Caries research. 1993.

(25)

25

23. Stipp RN, Boisvert H, Smith DJ, Höfling JF, Duncan MJ, Mattos-Graner RO. CovR and VicRK Regulate Cell Surface Biogenesis Genes Required for Biofilm

Formation in Streptococcus mutans. Msadek T, ed. PLoS ONE.

2013;8(3):e58271.

24. Nicholson JW. Chemistry of glass-ionomer cements: a review. Biomaterials [Internet]. 1998 Apr;19(6):485–94.

25. Mayanagi G, Igarashi K, Washio J, Domon-Tawaraya H, Takahashi N. Effect of fluoride-releasing restorative materials on bacteria-induced pH fall at the bacteria-material interface: An in vitro model study. J Dent. Elsevier Ltd; 2014;42(1):15–20.

26. Wexler DL, Hudson MC, Burne RA. Streptococcus mutans fructosyltransferase (ftf) and glucosyltransferase (gtfBC) operon fusion strains in continuous culture. Infect Immun. 1993 Apr 1 [cited 2015 May 7];61(4):1259–67.

27. Li Y, Burne R a. Regulation of the gtfBC and ftf genes of Streptococcus mutans in biofilms in response to pH and carbohydrate. Microbiology. 2001;147(10):2841–8.

28. Kreth J, Hagerman E, Tam K, Merritt J, Wong DTW, Wu BM, et al. Quantitative analyses of Streptococcus mutans biofilms with quartz crystal microbalance, microjet impingement and confocal microscopy. Biofilms. 2004 Oct;1(4):277–84. 29. Gilmour ASM, Edmunds DH, Newcombe RG. Prevalence and Depth of Artificial

Caries-like Lesions Adjacent to Cavities Prepared in Roots and Restored with a Glass Ionomer or a Dentin-bonded Composite Material. J Dent Res . 1997 Dec 1;76 (12 ):1854–61.

30. Silva RC, Zuanon ACC, Spolidorio DMP, Campos JADB. Antibacterial activity of four glass ionomer cements used in atraumatic restorative treatment. J Mater Sci Mater Med [. 2007;18(9):1859–62.

31. Duque C, Negrini T de C, Hebling J, Spolidorio DMP. Inhibitory activity of glass-ionomer cements on cariogenic bacteria. Oper Dent. 1999;30(5):636–40.

32. Basso GR, Della Bona a, Gobbi DL, Cecchetti D. Fluoride release from restorative materials. Braz Dent J. 2011;22(5):355–8.

33. Tenuta, Lívia Maria Andaló; Pascotto, Renata Corrêa; Navarro, Maria Fidela de Lima and Francischone, Carlos Eduardo.Rev Odontol Univ São Paulo [online]. 1997, vol.11, n.4, pp.Fluoride release of four restorative glass-ionomer cements 34. Marquis RE. Antimicrobial actions of fluoride for oral bacteria. Can J Microbiol.

(26)

35. Barboza-Silva E, Castro ACD, Marquis RE. Mechanisms of inhibition by fluoride of urease activities of cell suspensions and biofilms of Staphylococcus epidermidis, Streptococcus salivarius, Actinomyces naeslundii and of dental plaque. Oral Microbiol Immunol . Munksgaard International Publishers; 2005;20(6):323–32.

36. Sturr M, Marquis R. Inhibition of proton-translocating ATPases of Streptococcus mutans and Lactobacillus casei by fluoride and aluminum. Arch Microbiol . Springer-Verlag; 1990;155(1):22–7.

37. Lunardi J, Dupuis A, Garin J, Issartel JP, Michel L, Chabre M, et al. Inhibition of H+-transporting ATPase by formation of a tight nucleoside diphosphate-fluoroaluminate complex at the catalytic site. Proc Natl Acad Sci. 1988 Dec 1;85 (23 ):8958–62.

(27)

27

3 CONCLUSÃO

Baseando-se nos resultados obtidos, pôde-se concluir que:

1. O contato do biofilme de S. mutans com o cimento de ionômero de vidro diminuiu a expressão gênica de gtfC ,vicR e covR.

(28)

REFERÊNCIAS*

Ajdić D, McShan WM, McLaughlin RE, Savić G, Chang J, Carson MB, et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. U. S. A. 2002;99(22):14434–9.

Aoki H, Shiroza T, Hayakawa M, Sato S, Kuramitsu HK. Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis. Infect. Immun.1986

Auschill TM, Arweiler NB, Brecx M, Reich E, Sculean A, Netuschil L. The effect of dental restorative materials on dental biofilm. Eur. J. Oral Sci. 2002;110(1):48–53. Benelli EM, Serra MC, Rodrigues AL, Cury JA. In situ anticariogenic potential of glass ionomer cement. Caries Res. 1993.

Biswas I, Drake L, Erkina D, Biswas S. Involvement of sensor kinases in the stress tolerance response of Streptococcus mutans. J. Bacteriol. 2008;190(1):68–77.

Biswas S, Biswas I. Regulation of the glucosyltransferase (gtfBC) operon by CovR in Streptococcus mutans. J. Bacteriol. 2006;188(3):988–98.

Brentel a S, Kantorski KZ, Valandro LF, Fúcio SB, Puppin-Rontani RM, Bottino M a. Confocal laser microscopic analysis of biofilm on newer feldspar ceramic. Oper. Dent. 2011;36(1):43–51.

Chong P, Drake L, Biswas I. Modulation of covR expression in Streptococcus mutans UA159. J. Bacteriol. 2008;190(13):4478–88.

Dionysopoulos P, Kotsanos N, Papadogiannis Y, Konstantinidis A. Artificial secondary caries around two new F-containing restoratives. Oper. Dent. [Internet]. 1998;23(2):81—86.

Fúcio SBP, Carvalho FG, Sobrinho LC, Sinhoreti M a C, Puppin-Rontani RM. The influence of 30-day-old Streptococcus mutans biofilm on the surface of esthetic restorative materials-An in vitro study. J. Dent. 2008;36(10):833–9.

De Fúcio SBP, De Paula AB, De Carvalho FG, Feitosa VP, Ambrosano GMB, Puppin-Rontani RM. Biomechanical degradation of the nano-filled resin-modified glass-ionomer surface. Am. J. Dent. 2012;25(6):315–20.

De Fúcio SBP, Puppin-Rontani RM, De Carvalho FG, De Mattos-Graner RO, Correr-Sobrinho L, Garcia-Godoy F. Analyses of biofilms accumulated on dental restorative materials. Am. J. Dent. 2009;22(3):131–6.

*De acordo com as normas da UNICAMP/FOP, baseadas na padronização do International Committee of Medical Journal Editors - Vancouver Group. Abreviatura dos periódicos em conformidade com o PubMed.

(29)

29

Fujiwara T, Hoshino T, Ooshima T, Hamada S. Differential and quantitative analyses of mRNA expression of glucosyltransferases from Streptococcus mutans MT8148. J. Dent. Res. 2002;81(2):109–13.

Gilmour ASM, Edmunds DH, Newcombe RG. Prevalence and Depth of Artificial Caries-like Lesions Adjacent to Cavities Prepared in Roots and Restored with a Glass Ionomer or a Dentin-bonded Composite Material. J. Dent. Res. 1997 Dec 1;76 (12):1854–61.

Hamada S, Slade HD. Biology, immunology, and cariogenicity of Streptococcus mutans. Microbiol. Rev. 1980;44(2):331–84.

Hirose H, Hirose K, Isogai E, Miura H, Ueda I. Close Association between Streptococcus sobrinus in the Saliva of Young Children and Smooth-Surface Caries Increment. Caries Res. 1993;27(4):292–7.

Hüther FJ, Psarros N, Duschner H. Isolation, characterization, and inhibition kinetics of enolase from Streptococcus rattus FA-1. Infect. Immun. 1990. p. 1043–7.

Idone V, Brendtro S, Gillespie R, Kocaj S, Peterson E, Rendi M, et al. Effect of an Orphan Response Regulator on Streptococcus mutans Sucrose-Dependent Adherence and Cariogenesis. Infect. Immun. 2003 Aug 1;71 (8 ):4351–60.

Kawai K, Tsuchitani Y. Effects of resin composite components on glucosyltransferase of cariogenicbacterium. J. Biomed. Mater. Res. 2000;51(1):123–7.

Khalichi P, Cvitkovitch DG, Santerre JP. Effect of composite resin biodegradation products on oral streptococcal growth. Biomaterials. 2004;25(24):5467–72.

Loesche WJ. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 1986;50(4):353–80.

Lunardi J, Dupuis A, Garin J, Issartel JP, Michel L, Chabre M, et al. Inhibition of H+-transporting ATPase by formation of a tight nucleoside diphosphate-fluoroaluminate complex at the catalytic site. Proc. Natl. Acad. Sci. 1988 Dec 1;85 (23 ):8958–62. Marsh PD. Dental plaque: Biological significance of a biofilm and community life-style. J. Clin. Periodontol. 2005;32(SUPPL. 6):7–15.

Morrier JJ, Suchett-Kaye G, Nguyen D, Rocca JP, Blanc-Benon J, Barsotti O. Antimicrobial activity of amalgams, alloys and their elements and phases. Dent. Mater. 1998;14(2):150–7.

Nagamine M, Itota T, Torii Y, Irie M, Staninec M, Inoue K. Effect of resin-modified glass ionomer cements on secondary caries. Am. J. Dent. [Internet]. 1997;10(4):173—178. Nakajo K, Imazato S, Takahashi Y, Kiba W, Ebisu S, Takahashi N. Fluoride released from glass-ionomer cement is responsible to inhibit the acid production of caries-related oral streptococci. Dent. Mater. 2009;25(6):703–8.

(30)

Pandit S, Kim G-R, Lee M-H, Jeon J-G. Evaluation of Streptococcus mutans biofilms formed on fluoride releasing and non fluoride releasing resin composites. J. Dent. 2011;39(11):780–7.

Senadheera MD, Guggenheim B, Spatafora G a., Huang YCC, Choi J, Hung DCI, et al. A VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and ftf expression, biofilm formation, and genetic competence development. J. Bacteriol. 2005;187(12):4064–76.

Steinberg D, Eyal S. Early formation of Streptococcus sobrinus biofilm on various dental restorative materials. J. Dent. 2002;30(1):47–51.

(31)

31

Referências

Documentos relacionados