Vancomycin resistance
Rapid detection of Vancomycin-Resistant Enterococci (VRE) in rectal samples from patients admitted to intensive care units
... Various PCR protocols have been described to identify enterococci species and to detect vancomycin-resistance genotypes [7,21,22,23]. The method used in our study allows the simultaneous identification of ...
5
Successful treatment of vancomycin-resistant enterococcus ventriculitis in a child
... reported vancomycin resistance in ...of vancomycin-resistant cases ...for vancomycin-resistant enterococci are limited because these organisms are usually resistant to multiple antimicrobial ...
3
Incidência de Enterococcus resistente à vancomicina em hospital universitário no Brasil
... the vancomycin resistance in the clinical cultures that were positive for Enterococcus ...were vancomycin-resistant, and this increased to ...
5
Rev. Soc. Bras. Med. Trop. vol.48 número5
... Aldose epimerase (EF0955) bopC bopC_F TTAACCGACACCATTTCTGG bopC_R GTAGGCGTGGTTCGTAGGAT LacI family sugar-binding transcriptional regulator (EF0954) bopD bopD_F CAACTTGCGCAAATCTATGG bopD_R ATCGCCATTCGACCTAATTC FUR family ...
5
Evolution of multidrug resistance during Staphylococcus aureus infection involves mutation of the essential two component regulator WalKR.
... low-level resistance to last-line agents such as vancomycin and ...to vancomycin resistance was experi- mentally confirmed using bi-directional allelic exchange experi- ...
15
Reduced susceptibility to vancomycin and biofilm formation in methicillin-resistant Staphylococcus epidermidis isolated from blood cultures
... reduced vancomycin resistance have been approved by the US Food and Drug Administration and include li- nezolide, daptomycin, tigecycline and quinupristin/ dalfopristin (Micek ...and ...
8
No Outbreak of Vancomycin and Linezolid Resistance in Staphylococcal Pneumonia over a 10-Year Period.
... of vancomycin resistance, linezolid is the reserve antibiotic of choice ...and vancomycin in the treatment of Gram-positive bacterial infectious ...over vancomycin in the therapy of ...
20
Rev. Soc. Bras. Med. Trop. vol.45 número2
... for vancomycin and agreeably could not differentiate between vancomycin intermediate with vancomycin resistant Staphylococcus aureus ...showing vancomycin resistance by disc difusion, ...
2
PhD Teresa Braga.pdf
... of vancomycin resistance amongst enterococcal nosocomial ...of vancomycin to treat infections caused by multi-resistant Gram-positive ...Europe, vancomycin-resistant enterococci (VRE) are ...
168
Studies on resistance and response to vancomycin in Enterococcus faecalis: a last resort
... acquired resistance towards many of the antibiotics used in the clinical ...of vancomycin resistance by enterococci strains poses serious problem in terms of treatment and infection ...control. ...
426
Detection of both vanA vanB genes in vanA phenotypes of Enterococci by Taq Man RT-PCR
... ferring among Enterococci spp (Palladino et al., 2008, Emaneini et al., 2008, Japoni et al., 2009). Genes (vanA and vanB) encoding dipeptide like termini are responsible for high or moderate level vancomycin ...
5
Teicoplanin MICs range ( μμμμμgmL) Species (No. of strains) Agar dilution test Microscan WalkAway system
... to vancomycin only in Europe ...glycopeptides resistance. Experiments in vitro about the resistance to glycopeptides in Staphylococcus have shown that the acquisition of teicoplanin resistance ...
6
Rev. Soc. Bras. Med. Trop. vol.45 número4
... activity. Vancomycin is the primary choice for methicillin-resistant Staphylococcus aureus (MRSA) infection treatment; rifampicin has interesting antibioilm properties, but its efectivity remains poorly ...with ...
4
Effect of amikacin, cephalothin, clindamycin and vancomycin on in vitro
... Our results showed that there was no difference in en- zyme activity of control cells in relation to those that re- ceived clindamycin, cephalothin or vancomycin. When we added amikacin to the fibroblast cultures ...
6
Culinary resistance?
... of resistance be extended to the field of cuisine? To what extent can a group resist through food and cooking? This paper poses these two queries within the context of a Malaysian foodscape: the Kristangs, or ...
19
Vancomycin treatment of infective endocarditis is linked with recently acquired obesity.
... to vancomycin, was widely used in Europe as a growth promoter from the early 1970s until a recent ban due to the emergence of vancomycin-resistant enterococci ...
6
Prevalence of vancomycin-resistant Enterococcus fecal colonization among kidney transplant patients
... transferring resistance genes to vancomycin to other more virulent and more prevalent pathogens such as Staphylococcus aureus ...of vancomycin) or to those with a higher probability of transmission, ...
7
Vancomycin: the need to suit serum concentrations in hemodialysis patients
... Otherauthorshavesuggestedchangesindosingand intervalaccordingtotheadministrationregimenandthe typeofdialyzerused.However,reviewingstudiesonthe pharmacokineticso[r] ...
6
Braz. J. Chem. Eng. vol.29 número3
... Figure 1 shows the results of process simulation for vancomycin adsorption according to the proposed models, with the estimated parameters presented in Tables 1 and 2. The predicted concentration distributions ...
18
Avaliação de Tecnologia em Saúde: fatores associados ao nível sérico de vancomicina e impacto do ajuste de dose sobre o prognóstico de pacientes adultos internados no Hospital das Clínicas da Faculdade de Medicina de Botucatu
... for vancomycin prescription and monitoring of serum concentrations were issued by a consensus committee of three scientific ...Generic vancomycin formulations are widely used in developing countries, and ...
33