[PDF] Top 20 RAPD and SCAR markers linked to resistance to frogeye leaf spot in soybean

... USA) and a model 9600 thermocycler (Perkin-Elmer, Norwalk, CT, ...°C, and a 1 min extension step at 72 ...mersed in pH 8.0 TBE (90 mM Tris-borate buffer, 1 mM EDTA), and the DNA bands were ... See full document

... the RAPD marker amplified by the primer OPP07 showed to be in coupling phase, and the DNA fragment has around 857 ...ATA3’ and 5’TTTCCCGCCATAGAATATGTGAGA3’, and it is in ... See full document

... type and plant architecture were assessed in addition to ...22 to 24 g and non-flattened grains) to five, (cream-colored grain with dark brown stripes, dark underground, colored ... See full document

... RESUMO - O cancro da haste causado pelo fungo Diaporthe phaseolorum f. sp. meridionalis constitui-se em doença limitante para o cultivo da soja. Avaliações fenotípicas visando resistência a doenças envolve processos ... See full document

... angular leaf spot, considered one of the most important bean diseases in the State of Minas Gerais, ...identifying RAPD markers closely linked to the angular leaf ... See full document

... the markers linked with QTL present in genetic control of the traits evaluated, as well as similarity in the values of some parameters like genetic effects, a difference was observed in ... See full document

... simple and cost effective RAPD technique developed by Williams et ...alternative to RFLP analysis to identify markers linked to resistance genes against diseases ... See full document

... physically linked markers, one linkage group at a time, from the model (S4 ...submitted to NAM-Genome Wide Association Study (NAM-GWAS) at BioHPC for genome- wide single nucleotide polymorphisms ... See full document

... races in Central Brazil, also supplied by the Plant Sciences Department of the Federal University of ...upper and lower ...according to Casela et ... See full document

... toms and application of a grading scale, from ...leaflet, in millimeters; number of lesions per square centimeter (NLC), the number of lesions per leaflet divided by the area of the leaflet; percentage of ... See full document

... resistant and TAN – ...performed and two DNA bulks were obtained from homozygous resistant and homozygous susceptible plants, ...random RAPD primers analyzed, three were identi! ed as ... See full document

... extraction and analysis of SNP markers The population derived from the cross UFRGS 01B7114-1-3 x UFRGS 006013-1 was genotyped in this ...(SNP) markers using a genotyping platform developed for ... See full document

... yield and upright plant architecture, and line LM 200203999 was ...selected. In 2001, this line was evaluated in the Preliminary Test of Lines, along with 109 other lines and 4 controls ... See full document

... equivalent to the variation index, refers to the magnitude of the CV g /CV e ratio, and according to Resende and Duarte (2007), CVr values equal to ...high-accuracy and ... See full document

... for resistance to angular leaf spot, some alternatives are possible for the following selection ...is to increase the selection pressure for disease resistance or another ... See full document

... was to identify single-nucleotide polymorphism (SNP) markers linked with quantitative trait loci (QTLs) associated with increased contents of protein and oil in ...Brazilian ... See full document

... growth in selecive medium (Figure 2) were subcultured on the same medium to conirm their resistance to ...converted to full-ledged plants in which the expected 696 bp band was ... See full document

... male and female level of access and ownership to land for cassava production in Abia ...were to describe the socio-economic characteristics of the respondents, determine the differences ... See full document

... hybridization in buffelgrass (Dwivedi et ...was to develop an F 2 mapping population for genetic analysis of the apomixis trait and identification of molecular markers linked to ... See full document

... L. In: Simpósio de Pesquisa dos Cafés do Brasil, 4, 2005, Londrina – ...of resistance of Coffea sp. to leaf ...Identification and behaviour of four factors conditioning disease reaction ... See full document