[PDF] Top 20 NANDROLONE INCREASES ANGIOTENSIN-I CONVERTING ENZYME ACTIVITY IN RATS TENDONS

... of nandrolone modifies the angiotensin-I converting enzyme (ACE) activity and increases collagen deposition in the ...the Angiotensin-I ... See full document

... mass in order to understand the multifactorial etiology of ...functional in the white adipose tissue (WAT) and modulates its development, we reasoned whether early transitory inhibition of ... See full document

... (CRE) in basal and in induced angiotensin converting enzyme (ACE) gene promoter activity in order to shed light on the regulation of somatic ACE ...between rats, ... See full document

... homogenized in 10 w/v buffer (10 mM) Tris-HCl, 1 mM EDTA, and 250 mM sucrose, pH ...fraction, in which the 5' nucleotidase (plasma membrane marker) and alkaline phosphatase (brush bor- der membrane marker) ... See full document

... of nandrolone modifies the angiotensin-I converting enzyme (ACE) activity and increases collagen deposition in the ...the Angiotensin-I ... See full document

... difficult in anesthetized ...infarction in each indi- vidual ...small in- crease in the end-diastolic pressures of both ventricles is a clear indication that the ani- mals used in our ... See full document

... ACE activity in organs and tissues of normotensive and hypertensive ...mercury increases the activity of ACE and the relationship of such exposure with oxidative stress on heart, aorta, lung, ... See full document

... action in beta- adrenoceptors, stimulates protein synthesis in the adult rat heart and contributes to myo- cyte hypertrophy ...hypertrophy in the ...of angiotensin II on the myocytes. Thus, ... See full document

... Angiotensin-converting enzyme (ACE) is a dipeptidyl carboxypeptidase (EC ...stance angiotensin II (Ang II) by removal of the carboxy-terminal dipeptide of angiotensin I (Ang ... See full document

... be in 100 to 150 µM range (Table 1) ...rich in major anthocyanins ...ACE in a human umbilical vein endothelial cell (HUVEC) culture model and the ACE activity had been significantly reduced ... See full document

... ACE activity but also at the mRNA expression in the striatum and in the frontal ...cortex. In the case of the repeated regimen, it can also be interpreted as a response to the last cocaine ... See full document

... involved in blood pressure control, including angiotensin-converting enzyme (ACE), heme oxyge- nase (HO-1) and the endothelial-derived relaxing factor (EDRF) ...of angiotensin II (Ang ... See full document

... drugs in the management of hypertension worldwide, despite the absence of any consistent evidence of advantage over older agents, and the concern that they may be associated with lower renal protection and risk ... See full document

... but in our samples we detected a discrepancy in 19% of ...expertise in performing PCR gel electrophoresis ...bands in the gel) should be assessed by more than one observer to avoid ... See full document

... associated angiotensin-converting enzyme (ACE) D allele with variability in the skeletal muscle baseline strength, though conclusions have been inconsistent across ...strength in elite ... See full document

... reduction in lung volume was observed (right, ...observed in some regions (Figure ...hemorrhage in the head of the caudate nucleus and small hemorrhage in the IV ventricle were ...observed ... See full document

... The PCR-restriction fragment length polymorphism (RFLP) technique was used to investigate the C677T polymorphism (rs1801133) of the MTHFR gene. The MTHFR1 (sense) 5’TGAAGAAGGAGGTGTCTGCGG3’ and MTHFR2 (antisense) ... See full document

... Just as it is relevant to be aware of the epidemiology of classic risk factors for hypertension and evaluate the impact of each risk on morbimortality related to hypertension, the awareness of risk factors based on ... See full document

... E in the C-terminal for pepsin, peptide bonds with lateral aromatic, or hydrophobic chains (Y, W, F and M) on the carboxyl end of the bond for the α- chymotrypsin, and peptide bonds with R or K in the ... See full document

... form. In addition, we observed that patients with higher levels of ACE activity had a large left ventricular mass ...ACE activity in patients with HCM. Angiotensin I is converted ... See full document