Abst ract
Submitted: June 23, 2016 0RGL¿FDWLRQ$XJXVW Accepted: August 30, 2016
,QÀXHQFHRIJO\FHPLFFRQWURORQWKH
levels of subgingival per iodont al
pat hogens in pat ient s w it h generalized
chr onic per iodont it is and t ype 2
diabet es
2EMHFWLYH 7KLV VWXG\ HYDOXDWHG WKH LQÀXHQFH RI JO\FHPLF FRQWURO RQ WKH levels and frequency of subgingival periodont al pat hogens in pat ient s w it h t ype 2 diabet es m ellit us ( DM) and generalized chr onic per iodont it is ( ChP) . Mat er ial and Met hods: Fift y- six pat ient s w it h generalized ChP and t y pe 2 DM w er e assigned accor ding t o t he levels of glycat ed hem oglobin ( HbA1c) int o one of t he follow ing JURXSV+E$FQ RU+E$FQ 7KUHHVXEJLQJLYDOELR¿OP sam ples fr om sit es w it h pr obing dept h ( PD) < 5 m m and t hr ee sam ples fr om sit es ZLWK3'PPZHUHDQDO\]HGE\TXDQWLWDWLYH3RO\PHUDVH&KDLQ5HDFWLRQ3&5 for t he pr esence and levels of Por phyr om onas gingivalis, Tanner ella for syt hia,
Tr eponem a dent icola, Eubact er ium nodat um , Par vim ona m icr a, Fusobact er ium
nucleat um ssp. and Pr ev ot ella int er m edia. Result s: The m ean count s of F.
nucleat umVVSZHUHVWDWLVWLFDOO\VLJQL¿FDQWO\KLJKHULQWKHVLWHVZLWK3'PP
RIWKH+E$FJURXSS)UHTXHQFLHVRIGHWHFWLRQRIT. for syt hia, E. nodat um , P. m icr a and F. nucleat umVVSZHUHDOOKLJKHULQWKHVLWHVZLWK3'
PP RI WKH SDWLHQWV ZLWK +E$F FRPSDUHG ZLWK WKRVH RI SDWLHQWV ZLWK HbA1c< 8% ( p< 0.05) . Fr equency of det ect ion of P. int er m edia was higher in t he VLWHVZLWK3'PPRIWKHSDWLHQWVZLWK+E$FWKDQWKRVHRIWKHSDWLHQWV w it h HbA1c< 8% ( p< 0.05) . Conclusions: Poor glycem ic cont r ol, as indicat ed by +E$FLVDVVRFLDWHGZLWKLQFUHDVHGOHYHOVDQGIUHTXHQFLHVRISHULRGRQWDO SDWKRJHQVLQWKHVXEJLQJLYDOELR¿OPRIVXEMHFWVZLWKW\SH'0DQG&K3
Ke y w or ds: Chr onic per iodont it is. Diabet es m ellit us. Pat hogens. Real- t im e poly m erase chain r eact ion.
Tamires Szeremeske MIRANDA1
Magda FERES1
Belén RETAMAL-VALDÉS1
Paula Juliana PEREZ-CHAPARRO1
Suellen Silva MACIEL1
Poliana Mendes DUARTE1
1Univer sidade Guar ulhos, Cent r o de Pós- Graduação e Pesquisa, Guar ulhos, SP, Brasil.
Corresponding address: Poliana Mendes Duarte Universidade Guarulhos Centro de Pós-Graduação e Pesquisa Praça Tereza Cristina, 229 Centro -Guarulhos - SP - Brazil - 07.023-070 Phone: +55 (11) 2464-1758 - Fax: +55 (11) 2464-1758
I nt r oduct ion
Diabet es m ellit us ( DM) has been r ecognized as D PDMRU ULVN IDFWRU IRU SHULRGRQWLWLV VLQFH SDWLHQWV w it h DM pr esent higher pr evalence and sever it y of per iodont al diseases, com par ed w it h t hose w it hout DM. Pat ient s w it h DM and per sist ent poor glycem ic FRQWUROKDYHDQHYHQKLJKHUULVNRISHULRGRQWLWLVWKDQ t hose wit h good glycem ic cont rol. I n addit ion, effect ive cont r ol of glycem ia im pr oves per iodont al param et er s in pat ient s w it h t y pe 2 DM and per iodont it is9,14.
Sev er al m ech an i sm s, i n cl u d i n g al t er at i o n s i n t h e h ost r espon se an d in t h e com posit ion of t h e su b g i n g i v a l m i cr o b i o t a , h av e b een p r o p o sed t o ex plain gr eat er suscept ibilit y of subj ect s w it h DM t o SHULRGRQWDOEUHDNGRZQSDUWLFXODUO\LQSDWLHQWVZLWK poor ly cont r olled DM. Som e st udies have com par ed t h e im p act of g ly cem ic con t r ol on t h e im m u n e-LQÀDPPDWRU\ DVSHFWV RI VLWHV ZLWK SHULRGRQWLWLV LQ pat ient s w it h t y pe 2 DM. I n general, r esult s hav e show n t hat per iodont al sit es of subj ect s w it h t y pe 2 DM pr esent ing poor glycem ic cont r ol ar e associat ed w i t h p r o- i n f l am m at or y an d p r o- ost eocl ast og en i c SUR¿OHV7,21,22.
Regarding m icrobiological aspect s, previous st udies h av e co m p ar ed l ev el s o f p er i o d o n t al p at h o g en s in indiv iduals w it h and w it hout DM using differ ent m icr obiological t ech n iqu es1 , 6 , 8 , 2 0 , 2 3 , 2 9 , 3 0. How ev er, t o dat e, few invest igat ions have focused on t he im pact of glycem ic cont rol on t he subgingival m icroorganism s of pat ient s w it h DM1,10,17,20,24,28. Fur t her m or e, m ost of t hese st udies assessed t he occur r ence of a lim it ed QXPEHURISDWKRJHQVHVSHFLDOO\WKHIXQJDONLQJGRP and focused on t he evaluat ion of subj ect s w it h t y pe 1 DM. Ther efor e, t he possible effect of t he glycem ic co n t r o l o n p a t h o g e n i c b a ct e r i a l sp e ci e s i n t h e VXEJLQJLYDO ELR¿OP RI SDWLHQWV ZLWK W\SH '0 DQG per iodont it is is not w ell est ablished. Thus, t he aim of t his st udy is t o evaluat e t he im pact of glycem ic cont r ol on fr equencies and levels of seven per iodont al pat h ogen s (Tr epon em a den t icola, Por ph y r om on as gingivalis, Tannerella forsyt hia, Eubact erium nodat um , Par v im on a m icr a, Fu sob act er iu m n u cleat u m ssp .
a n d Pr e v o t e l l a i n t e r m e d i a) i n t h e su b g i n g i v a l ELR¿OPVDPSOHVRISDWLHQWVZLWKJHQHUDOL]HGFKURQLF per iodont it is ( ChP) and t y pe 2 DM.
Mat er ial and m et hods
Subj ect populat ion
Fift y- six subj ect s w it h t y pe 2 DM and generalized ChP3 w er e select ed am ong 390 volunt eer s scr eened f r om t h e popu lat ion r ef er r ed t o t h e Den t al Clin ic of Guar ulhos Univer sit y, fr om July 2011 t o Januar y 2 0 1 5 . Det ailed m ed ical an d d en t al r ecor d s w er e obt ained. Of t he 390 indiv iduals scr eened, 334 w er e excluded fr om par t icipat ing in t he st udy since t hey did not m eet inclusion cr it er ia. All eligible subj ect s ZHUH LQIRUPHG RI WKH QDWXUH SRWHQWLDO ULVNV DQG EHQH¿WVRIWKHLUSDUWLFLSDWLRQLQWKHVWXG\DQGVLJQHG an infor m ed consent for m . The Guar ulhos Univer sit y Clin ical Resear ch Et h ics Com m it t ee appr ov ed t h e st udy pr ot ocol.
I nclusion and exclusion cr it er ia
I n cl u si o n cr i t e r i a w e r e : \HDUV RI DJH
diagnosis of t y pe 2 '0IRU\HDUV'0WUHDWPHQW
w it h insulin supplem ent at ion, diet r egim e and/ or oral hypoglycem ic agent s, at least 15 t eet h ( excluding t hird m olar s and t eet h w it h advanced decay indicat ed for ex t ract ion) , m or e t han 30% of t he sit es w it h pr obing dept h (3'DQGFOLQLFDODWWDFKPHQWOHYHO&$/PP
and a m inim um of six t eet h w it h at least one sit e w it h
3'DQG&$/PPDQGEOHHGLQJRQSURELQJ%R3
Ex clu sion cr it er ia w er e: p r eg n an cy, lact at ion ,
FXUUHQW VPRNLQJ DQG VPRNLQJ ZLWKLQ WKH SDVW ¿YH
years, SRP in t he previous 12 m ont hs, use of syst em ic
DQWLELRWLFDQWLLQÀDPPDWRU\DQGLPPXQRVXSSUHVVLYH
m edicat ions during t he previous six m ont hs, cont inuous use of m out hr inses cont aining ant im icr obials in t he pr eceding t hr ee m ont hs, sy st em ic condit ions ( except DM) t hat could affect t he pr ogr ession of per iodont it is ( e . g ., i m m u n o l o g i ca l d i so r d e r s, o st e o p o r o si s) , n eed f or ex t en si v e p r ost h et i c r eh ab i l i t at i on an d m aj or com plicat ions of DM ( i.e., car diovascular and per ipheral vascular diseases [ ulcer s, gangr ene and am put at ion] , neur opat hy and nephr opat hy ) .
Exper im ent al gr oups
Blood sam ples of all subj ect s included in t he st udy w er e ex am ined at t he Clinical Analy sis Laborat or y of
Guar ulhos Univer sit y. Fast ing plasm a glucose ( FPG,
w er e assigned accor ding t o t heir levels of HbA1c int o one of t he follow ing gr oups: HbA1c< 8% ( n= 28) or +E$FQ
Clinical exam inat ion
Th e st u dy ex am in er ( T. M. S. ) par t icipat ed in a calibrat ion exercise, and st andard error of m easurem ent was calculat ed. I nt ra- exam iner variabilit y was 0.21 m m for PD and 0.24 m m for CAL. Agreem ent for cat egorical var iables [ e.g., BoP] was > 85% (Kappa- light t est ).
Visible plaque ( pr esence/ absence) , BoP ( pr esence/ absence) , suppurat ion (pr esence/ absence) , PD ( m m ) and CAL ( m m ) w er e assessed at six sit es per t oot h excluding t hir d m olar s using t he m anual per iodont al pr obe ( Nor t h Car olina - Hu- Fr iedy, Chicago, I L, USA) .
Micr obiological analyses
6L[VXEJLQJLYDOELR¿OPVDPSOHVSHUSDWLHQWZHUH
collect ed f r om n on - con t igu ou s in t er pr ox im al sit es pr esent ing no fur cat ion involvem ent ; t hr ee sit es fr om each of t he follow ing PD cat egor ies: PD< 5 m m and
3'PP$IWHUVXSUDJLQJLYDOSODTXHUHPRYDOELR¿OP
w as collect ed u sin g in div idu al st er ile m in i- Gr acey curet t es and placed in individual m icrot ubes cont aining 0.15 m L of TE ( 10 m M Tr is- HCl, 1 m M EDTA, pH 7.6) .
Quant it at ive Polym erase Chain React ion Test
( qPCR)
Sa m p l e s w e r e i n d i v i d u a l l y a n a l y ze d f o r t h e p r e se n ce a n d l e v e l s o f se v e n b a ct e r i a l sp e ci e s ( Tr epon em a den t icola, Por ph y r om on as gin giv alis,
Tanerella forsyt hia, Eubact erium nodat um , Parvim ona m icr a, Fusobact er ium nucleat um ssp. and Pr evot ella int er m edia) by qPCR, using Light Cycler 2.0 sy st em s
( Roche Diagnost ics Gm bH, Mannheim , Ger m any ) .
,QLWLDOO\ '1$ ZDV H[WUDFWHG IURP HDFK ELR¿OP
sam ple using t he Mast er Pur eTM com plet e DNA and 51$ SXUL¿FDWLRQ NLW (SLFHQWUH 0DGLVRQ :, 86$ $PSOL¿FDWLRQ UHDFWLRQV ZHUH SHUIRUPHG LQ D Nj/ ¿QDOYROXPHFRQWDLQLQJNj/RIWKHLVRODWHG'1$ QJNj/DQGDUHDFWLRQPL[WXUHFRQWDLQLQJSULPHU SUREHVHWVNj0HDFKDQG)DVW6WDUW'1$0DVWHU
SYBR Gr een I ( Roche Diagnost ics Gm bH, Mannheim ,
*HUPDQ\$EVROXWHTXDQWL¿FDWLRQRIWDUJHWVSHFLHV
in each sam ple was per for m ed using st andar d cur ves p r ep ar ed w it h r ef er en ce st r ain s ( Fig u r e 1 ) . Th e det er m inat ion of DNA cont ent in cont r ols was based on t he genom e size of each species and t he m ean w eight of one nucleot ide pair4. Based on st andar d
cur ves, indiv idual sam ple Ct scor es w er e conver t ed int o t he num ber of bact erial cells. The level of det ect ion was set t o 103 bact er ia. Poly m erase Chain React ion (PCR) p r o ced u r es w er e p er f o r m ed i n a b l i n d ed
IDVKLRQ 6SHFL¿F SULPHUV XVHG IRU WKH GHWHFWLRQ RI HDFKEDFWHULDOVSHFLHVHYDOXDWHGDQGWKHDPSOL¿FDWLRQ SUR¿OHVDUHGHVFULEHGLQ)LJXUH
St at ist ical analysis
The m inim um num ber of subj ect s included in t his st udy was based on a pr ev ious st udy t hat com par ed t he levels of r ed com plex species bet w een poor ly and w ell- cont r olled pat ient s w it h t y pe 2 DM using qPCR1. 'DWD ZHUH H[DPLQHG IRU QRUPDOLW\ E\ 6KDSLUR:LON t est and param et r ic m et hods w er e used for dat a t hat achieved nor m al dist r ibut ion. Clinical, glycem ic and m icrobiological param et ers were com put ed per subj ect
DQG DFURVV VXEMHFWV LQ ERWK JURXSV 6LJQL¿FDQFH RI
differ ences bet w een gr oups for age, durat ion of DM,
Species/reference strain Sequence $PSOL¿FDWLRQSUR¿OH [temperature (oC)/time (s)]
Length of PCR product (bp)
P. intermedia/ATCC 25611 5´ CCACATATGGCATCTGACGTG
ƍ7&$$7&7*&$&*&7$&77**& 95/10, 59/10, 72/10 233
P. gingivalis/ATCC 33277 ¶7*&$$&77*&&77$&$*$*** 95/10, 57/10, 72/14 344
T. forsythia/ATCC 43037 ¶*$7$**&77$$&$&$7*&$$*7&
ƍ$&7&*7$7&*&&&*77$77& 95/10, 57/10, 72/4 99
E. nodatum/ATCC 33099 ¶&77&**$$&$*7**$*$&
ƍ&7&7*7*$&**&&$77* 95/10, 56/10, 72/9 225
P. micra/ATCC 33270 ¶7*$*&$$&&7$&&77$&$&$* 95/10, 56/10, 72/5 112
F. nucleatum ssp. /ATCC 10953 ¶*&*&*7&7$**7**77$7
ƍ7$*77&&*&77$&&7&7&&$* 95/10, 58/10, 72/4 105
T. denticola/ATCC 35405 ¶*$&*&$$$&*&$77$$*7*
ƍ*&7$&*&7*&&$7$7&7 95/10, 56/10, 72/7 174
clin ical par am et er s, bact er ial lev els an d gly cem ic p ar am et er s w er e com p ar ed b y St u d en t ’s t - t est . Fisher ’s ex act t est com par ed t he fr equency of gender and DM t r eat m ent bet w een gr oups. The Chi- squar e t est w as u sed t o com par e t h e f r equ en cy of sit es
ZLWK 3' PP DQG VLWHV ZLWK 3' PP FRORQL]HG
by pat h ogen s. Cor r elat ion s bet w een t h e lev els of HbA1c and t he levels of each per iodont al pat hogen consider ing all sit es and t he sit es w it h PD< 5 m m
DQGZLWK3'PPVHSDUDWHO\ w er e per for m ed using Pear son’s Cor r elat ion. /HYHO RI VLJQL¿FDQFH ZDV VHW
at 5% .
Parameters HbA1c< 8% +E$F p-value
*HQGHU0)Q 18/16 12/16 0.11
$JHPHDQ6'\HDUV 55.4±6.1 51.7±8.7 0.07
Duration of DM (years) 5.0±5.8 5.0±6.7 0.98
Hb1A (%) 6.9±1.0 9.9±1.5 0.02
FPG (mg/dl) 122±31 177±32 0.04
6LWHVZLWKSODTXHDFFXPXODWLRQ (%)
81.0±16.4 73.1±25.3 0.17
6LWHVZLWKEOHHGLQJRQ probing (%)
37.1±13.2 37.5±16.8 0.93
Mean PD (mm) 3.8±0.7 3.5±0.5 0.14
Mean CAL (mm) 4.7±1.3 4.5±0.8 0.56
6LWHVZLWK3'PP 27.3 ±13.7 27.1 ±11.7 0.83
3'SURELQJGHSWK&$/FOLQLFDODWWDFKPHQWOHYHO+E$FJO\FDWHGKHPRJORELQ)3*IDVWLQJSODVPDJOXFRVH6'VWDQGDUGGHYLDWLRQ$ SYDOXHLQGLFDWHVGLIIHUHQFHVEHWZHHQJURXSVE\WKH6WXGHQW¶VWWHVWS7KHUHZHUHQRGLIIHUHQFHVEHWZHHQJURXSVIRUJHQGHU E\WKH)LVKHUVH[DFWWHVWS!
Table 1- Demographic characteristics, glycemic parameters (mean ± SD) and full-mouth clinical parameters (mean ± SD) of both groups of the study population
Species Sites HbA1c<8% +E$F p-value
T. denticola All PD 4.7±1.3 4.4±1.4 0.17
3'PP 4.6±1.4 4.0±1.6 0.19
3'PP 5.1±1.5 5.1±1.5 0.34
P. gingivalis All PD 3.7±1.4 3.8±1.6 0.44
3'PP 3.4±1.6 3.4±1.8 0.88
3'PP 4.5±2.2 4.6±1.8 0.79
T. forsythia All PD 3.9±1.2 4.0±1.0 0.22
3'PP 3.8±1.3 3.5±1.2 0.45
3'PP 4.3±1.6 4.8±0.9 0.12
E. nodatum All PD 3.8±1.1 3.7±0.9 0.35
3'PP 3.7±1.1 3.3±1.1 0.71
3'PP 3.9±1.1 4.4±0.8 0.11
P. micra All PD 4.2±1.2 4.3±1.2 0.23
3'PP 4.2±1.2 3.9±1.4 0.42
3'PP 4.3±1.7 4.9±1.7 0.13
F. nucleatum ssp. All PD 4.7±1.2 4.8±1.0 0.29
3'PP 4.7±1.3 4.5±1.3 0.58
3'PP 4.6±1.5 5.4±0.7 0.02
P. intermedia All PD 3.8±1.4 3.9±1.5 0.83
3'PP 3.7±1.5 3.8±1.7 0.25
3'PP 4.0±1.5 4.0±1.5 0.91
6'VWDQGDUGGHYLDWLRQ$SYDOXHLQGLFDWHVGLIIHUHQFHVEHWZHHQJURXSV6WXGHQW¶VWWHVWS
Result s
Tab le 1 p r esen t s d em og r ap h ic ch ar act er ist ics, gly cem ic and clinical param et er s for bot h gr oups.
7KHUH ZHUH QR VWDWLVWLFDOO\ VLJQL¿FDQW GLIIHUHQFHV
bet w een gr oups for gender, age, durat ion of DM and for all clinical param et er s ( p> 0.05). As ex pect ed, t he
+E$FJURXSSUHVHQWHGVLJQL¿FDQWORZHUOHYHOVRI +E$FDQG)3*WKDQWKH+E$FJURXSS DM t r eat m ent r epor t ed by t he pat ient s of bot h gr oups included diet r egim en and use of oral hy poglycem ic a g e n t ( m e t f o r m i n a n d / o r g l i b e n c l a m i d e ) . Th e frequency of pat ient s t hat w ere using t he com binat ion of m et for m in and glibenclam ide and t he single- dr ug t r eat m ent s did not differ bet w een gr oups ( p> 0.05).
Table 2 pr esent s count s of per iodont al pat hogens
for all sit es and for sit es ZLWK3'PPDQGZLWK3'
m m for bot h gr oups. Ther e w er e no differ ences in m ean num bers of alm ost all bact erial species bet w een gr ou ps, con sider in g all sit es as w ell as sit es w it h
3'PPDQG3'PP( p> 0.05). Mean levels of F.
nucleat um ssp. ZHUHVWDWLVWLFDOO\VLJQL¿FDQWO\KLJKHULQ WKHVLWHVZLWK3'PPRIWKH+E$FJURXSWKDQ in t hose of t he HbA1c< 8% gr oup ( p< 0.05) .
The per cent ages sit es ZLWK3'PPDQG3'
m m colon ized by per iodon t al pat h ogen s f or bot h g r ou p s ar e p r esen t ed in Tab le 3 . Fr eq u en cies of det ect ion of T. for syt hia, E. nodat um , P. m icr a and
F. nucleat um ssp w er e higher in t he VLWHVZLWK3'
m m of t h e +E$F JURXS FRPSDUHG ZLWK WKH
HbA1c< 8% gr oup ( p< 0.05) . Fr equency of det ect ion of P. int er m edia was higher in sit es w it h PD< 5 m m of
t he +E$FJURXSFRPSDUHGZLWKWKH+E$F
gr oup ( p< 0.05) .
$FFRUGLQJ WR 7DEOH LQ WKH +E$F JURXS count s of P. m icr a and T. for syt hia in t he sit es w it h PD< 5 m m SUHVHQWHG ZHDN SRVLWLYH FRUUHODWLRQV
w it h levels of HbA1c ( p< 0.05) . Fur t her m or e, count s of P. int er m edia in t he VLWHV ZLWK 3' PP of t he +E$F JURXS H[KLELWHG PRGHUDWH SRVLWLYH cor r elat ion w it h levels of HbA1c ( p< 0.05) .
Discussion
This st udy evaluat ed t he fr equency of det ect ion an d lev els of sev en per iodon t al pat h ogen s in t h e VXEJLQJLYDO ELR¿OP RI SRRUO\ DQG EHWWHUFRQWUROOHG pat ient s wit h t ype 2 DM and ChP. Result s indicat ed t hat SRRUO\FRQWUROOHGVXEMHFWVGH¿QHGDV+E$F11,18, har bor ed higher count s of F. nucleat um in t he sit es
ZLWK 3' PP, com p ar ed w it h b et t er con t r olled pat ient s ( HbA1c< 8% ) . Mor eover, per iodont al sit es of individuals wit h crit ical glycem ic cont rol dem onst rat ed an incr eased fr equency of det ect ion of T. for syt hia and of t he four orange com plex species st udied, w hen com pared wit h t hose of pat ient s wit h bet t er- cont rolled JO\FHPLD7KHVH¿QGLQJVVXJJHVWWKDWSRRUJO\FHPLF cont r ol in subj ect s w it h t y pe 2 DM is associat ed w it h DPRUHSDWKRJHQLFVXEJLQJLYDOPLFURELDOSUR¿OHZKLFK could cont r ibut e, at least in par t , t o t he w or sened
Groups
Species Sites HbA1c < 8% +E$F p-value
T. denticola 3'PP 90.00% 82.90% 0.11
3'PP 87.50% 96.40% 0.08
P. gingivalis 3'PP 79.30% 76.60% 0.63
3'PP 80.30% 91.00% 0.1
T. forsythia 3'PP 88.30% 87.40% 0.83
3'PP 83.90% 96.40% 0.02
E. nodatum 3'PP 89.20% 85.60% 0.42
3'PP 82.10% 96.40% 0.01
P. micra 3'PP 91.90% 89.20% 0.15
3'PP 83.90% 98.20% 0.008
F. nucleatum ssp. 3'PP 90.90% 90.00% 0.81
3'PP 83.90% 98.20% 0.008
P. intermedia 3'PP 73.00% 90.00% 0.007
3'PP 83.90% 92.80% 0.14
periodont it is observed in t hese subj ect s16. Not ewort hy, SUHYLRXVVWXGLHVIURPWKHPHGLFDO¿HOGKDYHVKRZQ t hat pat ient s w it h t y pe 2 DM pr esent ing inadequat e JO\FHPLFFRQWUROFDQEHDWKLJKHUULVNIRUGHYHORSLQJ sev er al t y p es of in f ect ion s1 1 , 1 3, cor r ob or at in g t h e pr esent ev idence dem onst rat ing t he possible im pact of hy per glycem ia on infect ious diseases.
6LWHVZLWK3'PP of pat ient s wit h t ype 2 DM wit h +E$FKDGKLJKHUPHDQOHYHOVDQGSUHYDOHQFHRI
F. nucleat um , com pared wit h t hose of t he pat ient s wit h
HbA1c< 8% . F. nucleat um is an anaer obic per iodont al pat hogen w hose pr evalence incr eases as t he sever it y and pr ogr ession of per iodont al diseases incr ease27. The pat hogenic act iv it ies of F. nucleat um involve t he product ion of virulence fact ors t hat enable t his species t o aggr egat e w it h ot her species in m ixed infect ions, t o adher e t o host m olecules and t o invade host cells. Because of it s abilit y t o aggregat e wit h ot her suspect ed pat hogens in per iodont al diseases, F. nucleat um act s as a br idge bet w een ear ly and lat e colonizer s dur ing ELR¿OPIRUPDWLRQ12,26. I n support of t he current result s, 6DNDODXVNLHQHHWDO20 ( 2014) obser ved a r elat ionship bet w een t he pr esence of F. nucleat um and HbA1c lev els in pat ient s w it h t y pe 1 DM. Ther efor e, it is VXSSRVHGWKDWWKHFRORQL]DWLRQRISHULRGRQWDOSRFNHWV by F. nucleat um m ay be affect ed by env ir onm ent al fact or s such as hy per glycem ia. Fur t her st udies ar e UHTXLUHGWRFRQ¿UPWKLVK\SRWKHVLV
Alt hough F. nucleat um was t he only species t hat differ ed in count s bet w een gr oups, t he pr evalence of d et ect ion of T. f or sy t h ia, E. n od at u m an d P. m icr a w er e KLJKHULQWKHVLWHVZLWK3'PP of t he pat ient s w it h +E$F ,Q DGGLWLRQ FRXQWV RIP. int er m edia in t his cat egor y of PD ex hibit ed m oderat e
posit ive cor r elat ion w it h t he levels of HbA1c in poor ly cont r olled subj ect s. Ter vonen, et al.28 ( 1994) show ed t h at t h e d u r at ion , t y p e an d m et ab olic con t r ol of t he subj ect s w it h DM ( t y pe 1 and t y pe 2) had no VLJQL¿FDQWHIIHFWRQWKHSUHYDOHQFHRIAggregat ibact er act in om y cet em com it an s, F. n u cleat u m , Eik en ella
corrodens, P. gingivalis and P. int erm edia. On t he ot her
hand, in anot her previous st udy, levels of P. gingivalis,
T. dent icola and T. forsyt hia w ere posit ively correlat ed
w it h HbA1c in subj ect s w it h t y pe 2 DM1. Mor eover, t h e f r equ en cy of det ect ion of T. f or sy t h ia an d T.
dent icola was correlat ed wit h poorer m et abolic cont rol
in subj ect s w it h t y pe 1 DM24. I n addit ion, elevat ed levels of HbA1c w er e r elat ed t o a higher fr equency of det ect ion of P. gin giv alis af t er t h e per iodon t al t r eat m ent of subj ect s w it h t y pe 2 DM17. Diver gences am ong st udies r egar ding t he species of per iodont al pat hogen affect ed by poor glycem ic cont r ol m ay be at t r ibut ed t o differ ences in t y pe of DM, PD of t he sam pled sit es, severit y of hyperglycem ia and m et hods used for bact erial det ect ion. Nevert heless, t he m aj orit y of t h is ab ov e- m en t ion ed ev id en ce in d icat es t h at HbA1c < 8% group
T. denticola P. gingivalis T. forsythia E. nodatum P. micra F. nucleatum
ssp
P. intermedia
r p r p r p r p r p r p r p
All sites HbA1c
0.051 0.796 0.087 0.658 0.153 0.435 0.13 0.508 0.135 0.491 0.046 0.814 -0.044 0.822
6LWHVZLWK3'
PP+E$F -0.047 0.812 -0.015 0.936 0.092 0.639 0.091 0.642 0.052 0.789 0.027 0.888 -0.082 0.676 6LWHVZLWK3'
PP+E$F 0.219 0.261 0.213 0.274 0.202 0.3 0.169 0.388 0.229 0.239 0.057 0.77 0.016 0.932
+E$FJURXS
T. denticola P. gingivalis T. forsythia E. nodatum P. micra F .nucleatum
ssp
P. intermedia
r p r p r p r p r p r p r p
All sites HbA1c
0.023 0.906 0.269 0.165 0.338 0.078 0.3 0.12 0.368 0.053 0.29 0.133 0.192 0.325
6LWHVZLWK3'
PP+E$F 0.111 0.573 0.341 0.074 0.369 0.042 0.333 0.082 0.376 0.048 0.286 0.139 0.246 0.206 6LWHVZLWK3'
PP+E$F -0.166 0.396 0.067 0.735 0.156 0.427 0.062 0.75 0.276 0.155 0.23 0.237 0.583 0.044
3HDUVRQ&RUUHODWLRQS
LQDGHTXDWHJO\FHPLFFRQWUROPLJKWLQÀXHQFHWRVRPH H[WHQWWKHFRORQL]DWLRQRIWKHSHULRGRQWDOSRFNHWVRI subj ect s w it h DM by pat hogens. These m icrobiological UHVXOWVPLJKWVXSSRUWSUHYLRXVLPPXQRORJLFDO¿QGLQJV dem onst rat ing t hat poor glycem ic cont rol is associat ed w it h elevat ed OHYHOV RI SURLQÀDPPDWRU\ F\WRNLQHV VXFKDVLQWHUOHXNLQ,/,/DQGUHFHSWRUDFWLYDWRU RI QXFOHDU IDFWRUNDSSD % 5$1./ DQG GHFUHDVHG OHYHOVRIDQWLLQÀDPPDWRU\F\WRNLQHVVXFKDV,/7,21,22.
$QLPSRUWDQW¿QGLQJRIWKHFXUUHQWVWXG\LVWKDW sit es w it h PD< 5 m m, i.e., t he shallow er sit es, of t he VXEMHFWVZLWK+E$FSUHVHQWHGDKLJKHUIUHTXHQF\ of det ect ion of P. int er m edia t han t hose of subj ect s w it h HbA1c< 8% . I n addit ion, num ber s of T. for syt hia and P. m icr a in t hese sit es of t he poor ly- cont r olled su b j ect s w er e slig h t ly p osit iv ely cor r elat ed w it h t he levels of HbA1c. T. for syt hia and P. int er m edia ar e classical per iodont al pat hogens w it h an ar senal o f v i r u l en ce f a ct o r s ( e. g ., p r o t eo l y t i c en zy m es, su r face- lay er an d lipopr ot ein s, leu cin e- r ich r epeat BspA pr ot ein et c.) t hat st im ulat es t he host im m une an d i n f l am m at or y r esp on ses an d , con seq u en t l y, WKH SHULRGRQWDO EUHDNGRZQ1 9 , 2 5 , 2 7. Fu r t h er m or e, P.
m icr a has been r ecognized as a put at ive per iodont al
p at h og en f ou n d in h ig h f r eq u en cy an d lev els in ChP lesions t hat is able t o pr edict t he w or sening of per iodont al param et er s2,27. Ther efor e, it seem s t hat WKH QHJDWLYH LQÀXHQFH RI JO\FHPLF FRQWURO RQ WKH VXEJLQJLYDO ELR¿OP LV QRW RQO\ OLPLWHG WRsit es w it h
3'PP, but also ex t ends t o t hose w it h low er PD. I nt erest ingly, a previous st udy from our group showed t hat uncont r olled subj ect s w it h t y pe 2 DM ex hibit ed a
K\SHULPPXQHLQÀDPPDWRU\ response even in shallow sit es57KHGLUHFWLPSOLFDWLRQRIWKHVH¿QGLQJVLVt hat shallow sit es of pat ient s w it h unsat isfact or y glycem ia PD\EHDWULVNRIIXWXUHSHULRGRQWDOEUHDNGRZQGXH t o t he bact er ial challenge and t he ex acer bat ed host r esponse t o pat hogens. Ther efor e, it is supposed t hat sit es w it h PD< 5 m m in poor ly- con t r olled pat ien t s should r eceive opt im um per iodont al t herapy sim ilar t o t hat pr ov ided for deeper sit es.
The m ain st r engt h of t his st udy was assessm ent of t he pr evalence and lev els of sev en per iodont al pat hogens, including t he t hr ee species of t he r ed com plex and four species of t he orange com plex, using a quant it at ive sensit ive m et hod of PCR. I n addit ion, t he pat ient s fr om bot h gr oups w er e m at ched for age, gender, durat ion and t r eat m ent r egim en of DM, as w ell as for sever it y of per iodont it is at full- m out h and
sam pled sit es levels. Fur t her m or e, HbA1c analy sis was per for m ed in t he sam e laborat or y using t he sam e m et hod.
Cer t ain lim it at ion s sh ou ld be con sider ed w h en in t er p r et in g t h e cu r r en t f in d in g s. Fir st , f r om t h e cur r ent st udy design, it is not possible t o det er m ine t h e act u al m ech an ism s b y w h ich in cr eased lev el of g ly cem ia/ Hb A1 c m ig h t f av or in cr eased cou n t s of som e pat h ogen s in dif f er en t PD cat egor ies. I t LV XQNQRZQ ZKHWKHU K\SHUJO\FHPLD PLJKW GLUHFWO\ alt er t h e n u t r it ion al an d env ir on m en t al f act or s in WKH SRFNHW IRVWHULQJ WKH FRORQL]DWLRQSHUVLVWHQFH of pat hogens t hat t r igger an ex acer bat ed im m une-LQÀDPPDWRU\ UHVSRQVH ZKHWKHU WKH SRRU JO\FHPLF FRQWUROVWLPXODWHVK\SHULQÀDPPDWLRQLQWKHSRFNHW env ir on m en t , f av or in g in dir ect ly t h e colon izat ion / persist ence of pat hogens, or bot h. Therefore, t he cyclic or sy ner gic int eract ions bet w een m icr obiological and im m unological com ponent s in t he per iodont al sit es of poor ly- cont r olled pat ient s t hat incr ease per iodont al dest r uct ion should be bet t er elucidat ed. I n addit ion, alt hough ev idence has suggest ed t hat per iodont al in fect ion m ay im pair adequ at e gly cem ic con t r ol1 5, t he cur r ent st udy is not able t o est ablish w het her t he REVHUYHGDOWHUHGSDWKRJHQSUR¿OHPLJKWFRQWULEXWHWR incr eased insulin r esist ance and poor glycem ic cont r ol RUYLFHYHUVD7KLUG+E$FZDVFKHFNHGRQO\RQFHLQ each pat ient , UHÀHFWLQJWKHJO\FHPLFFRQWUROr est r ict ed t o t he pr ev ious one t o t hr ee m ont hs. Fur t her m or e, since t his st udy is lim it ed t o only one point in t im e, t he act ual clinical consequences of t hese m icr obiological ¿QGLQJVVKRXOGEHDVVHVVHGRYHUDORQJHUIROORZXS of t hese poor ly- cont r olled subj ect s. Finally, fur t her ev alu at ion s assessin g t h e ef f ect s of t h e gly cem ic FRQWURORQWKHVXEJLQJLYDOELR¿OPRIWKHVHVXEMHFWV ZRXOGEHLPSRUWDQWWRDGGWRWKHFXUUHQW¿QGLQJV
I n conclusion, poor glycem ic cont r ol, as indicat ed by +E$FLVDVVRFLDWHGZLWKLQFUHDVHGOHYHOVDQG
frequencies of periodont al pat hogens in t he subgingival ELR¿OPRIVXEMHFWVZLWKW\SH'0DQG&K3
$FNQRZOHGJHPHQWV
This st udy was suppor t ed by FAPESP –São Paulo Resear ch Foundat ion ( São Paulo, São Paulo, Brazil, # 2011/ 14872- 4; 2013/ 01072- 5) .
&RQÀLFWRI,QWHUHVW
Refer ences
$HPDLPDQDQ3$PLPDQDQ37DZHHFKDLVXSDSRQJ64XDQWL¿FDWLRQ RINH\SHULRGRQWDOSDWKRJHQVLQLQVXOLQGHSHQGHQWW\SHGLDEHWLFDQG
non- diabet ic pat ient s w it h generalized chronic periodont it is. Anaerobe.
2013; 22: 64- 8.
2- Al- hebshi NN, Al-Alim i A, Taiyeb-Ali T, Jaafar N. Quant it at ive analysis
of classical and new put at ive per iodont al pat hogens in subgingival
ELR¿OPDFDVHFRQWUROVWXG\-3HULRGRQWDO5HV $UPLWDJH*&'HYHORSPHQWRIDFODVVL¿FDWLRQV\VWHPIRUSHULRGRQWDO
diseases and condit ions. Ann Per iodont ol. 1999: 4: 1- 6.
4- Dolezel J, Bar t os J, Voglm ay r H, Gr eilhuber J. Nuclear DNA cont ent
and genom e size of t r out and hum an. Cy t om et r y A. 2003; 51: 127- 8.
5 - Du ar t e PM, Bezer r a JP, Mir an d a TS, Fer es M, Ch am b r on e L,
6KDGGR[/0/RFDOOHYHOVRILQÀDPPDWRU\PHGLDWRUVLQXQFRQWUROOHG
t y pe 2 diabet ic subj ect s w it h chr onic per iodont it is. J Clin Per iodont ol.
2014; 41: 11- 8.
(EHUVROH -/ +ROW 6& +DQVDUG 5 1RYDN 0- 0LFURELRORJLF DQG
i m m u n o l o g i c ch ar act er i st i cs o f p er i o d o n t al d i sease i n Hi sp an i c
am er icans w it h t y pe 2 diabet es. J Per iodont ol. 2008; 79: 637- 46.
7- Engebr et son SP, Hey- Hadav i J, Ehr har dt FJ, Hsu D, Celent i RS,
*UELF -7 HW DO *LQJLYDO FUHYLFXODU ÀXLG OHYHOV RI LQWHUOHXNLQEHWD
and glycem ic cont r ol in pat ient s w it h chr onic per iodont it is and t y pe 2
diabet es. J Per iodont ol. 2004; 75: 1203- 8.
)LHOG&$*LGOH\0'3UHVKDZ30-DNXERYLFV1,QYHVWLJDWLRQDQG TXDQWL¿FDWLRQ RI NH\ SHULRGRQWDO SDWKRJHQV LQ SDWLHQWV ZLWK W\SH
diabet es. J Per iodont al Res. 2012; 47: 470- 8.
*DUFLD'7DULPD62NXQVHUL&3HULRGRQWLWLVDQGJO\FHPLFFRQWURO
in diabet es: NHANES 2009 t o 2012. J Per iodont ol. 2015; 86: 499- 506.
10- Ham m ad MM, Dar wazeh AM, I dr ees MM. The effect of glycem ic
cont r ol on Candida colonizat ion of t he t ongue and t he subgingival
plaque in pat ient s w it h t y pe I I diabet es and per iodont it is. Oral Sur g
Oral Med Oral Pat hol Oral Radiol. 2013; 116: 321- 6.
11- Han HS, Kang SB. Relat ions bet w een long- t er m glycem ic cont r ol
DQGSRVWRSHUDWLYHZRXQGDQGLQIHFWLRXVFRPSOLFDWLRQVDIWHUWRWDONQHH
ar t hr oplast y in t y pe 2 diabet ics. Clin Or t hop Sur g. 2013; 5: 118- 23.
12- Han YW. Fusobact erium nucleat um : a com m ensal- t urned pat hogen.
Cur r Opin Micr obiol. 2015; 23: 141- 7.
13- I zadi M, Fazel M, Karbasi-Afshar R, Saadat SH, Nasseri MH,
Jonaidi-Jafar i N, et al. Glycem ic cont r ol in t y pe 2 diabet es m ellit us pr event s
cor onar y ar t er ial wall infect ion. ARYA At her oscler. 2014; 10: 141- 6.
14- Kat agir i S, Nit t a H, Nagasawa T, I zum i Y, Kanazawa M, Mat suo
A, et al. Effect of glycem ic cont r ol on per iodont it is in t y pe 2 diabet ic
pat ient s w it h per iodont al disease. J Diabet es I nvest ig. 2013; 4: 320- 5.
/LQGHQ*-+HU]EHU0&:RUNLQJJURXSRIMRLQW()3$$3ZRUNVKRS 3HULRGRQWLWLVDQGV\VWHPLFGLVHDVHVDUHFRUGRIGLVFXVVLRQVRIZRUNLQJ JURXSRIWKH-RLQW()3$$3:RUNVKRSRQ3HULRGRQWLWLVDQG6\VWHPLF
Diseases. J Clin Per iodont ol. 2013; 14: 20- 3.
16- Llam bés F, Ar ias- Her r era S, Caffesse R. Relat ionship bet w een
diabet es and per iodont al infect ion. Wor ld J Diabet es. 2015; 6: 927- 35.
0DNLXUD12MLPD0.RX<)XUXWD12NDKDVKL16KL]XNXLVKL6
et al. Relat ionship of Por phyr om onas gingivalis w it h glycem ic level in
pat ient s w it h t y pe 2 diabet es follow ing per iodont al t r eat m ent . Oral
Micr obiol I m m unol. 2008; 23: 348- 51.
3DUN-,%DH(.LP</.DQJ6:<DQJ&:.LP1+HWDO*O\FHPLF
cont r ol and m or t alit y in diabet ic pat ient s under going dialy sis focusing
on t he effect s of age and dialy sis t y pe: a pr ospect ive cohor t st udy in
Kor ea. PloS One. 2015; 10: e0136085.
19- Ruan Y, Shen L, Zou Y, Qi Z, Yin J, Jiang J, et al. Com parat ive
genom e analy sis of Pr evot ella int er m edia st rain isolat ed fr om infect ed
r oot canal r eveals feat ur es r elat ed t o pat hogenicit y and adapt at ion.
BMC Genom ics. 2015; 16: 1- 22.
6DNDODXVNLHQH - .XELOLXV 5 *OHL]Q\V $ 9LWNDXVNLHQH $ ,YDQDXVNLHQH(âDIHULV95HODWLRQVKLSRIFOLQLFDODQGPLFURELRORJLFDO
var iables in pat ient s w it h t y pe 1 diabet es m ellit us and per iodont it is.
Med Sci Monit . 2014; 20: 1871- 7.
21- Sant os VR, Lim a JA, Gonçalves TE, Bast os MF, Figueir edo LC,
6KLEOL-$HWDO5HFHSWRUDFWLYDWRURIQXFOHDUIDFWRUNDSSD%OLJDQG
ost eopr ot eger in r at io in sit es of ch r on ic per iodon t it is of su bj ect s
w it h p oor ly an d w ell- con t r olled t y p e 2 d iab et es. J Per iod on t ol.
2010; 81: 1455- 65.
22- Sant os VR, Ribeir o FV, Lim a JA, Napim oga MH, Bast os MF, Duar t e
30&\WRNLQHOHYHOVLQVLWHVRIFKURQLFSHULRGRQWLWLVRISRRUO\FRQWUROOHG
an d w ell- con t r olled t y p e 2 d iab et ic su b j ect s. J Clin Per iod on t ol.
2010; 37: 1049- 58.
6DUGL -& 'XTXH & &DPDUJR *$ +RÀLQJ -) *RQoDOYHV 5%
Periodont al condit ions and prevalence of put at ive periodont opat hogens
and Candida spp. in insulin- dependent t ype 2 diabet ic and non- diabet ic
pat ient s w it h chr onic per iodont it is - a pilot st udy. Ar ch Oral Biol.
2011; 56: 1098- 105.
6FKDUD56NDOHULF(6HPH.6NDOHULF83UHYDOHQFHRISHULRGRQWDO
pat hogens and m et abolic cont ol of t y pe 1 diabet es pat ient s. J I nt Acad
Per iodont ol. 2013; 15: 29- 34.
2 5 - Sh ar m a A. Vi r u l en ce m ech an i sm s o f Tan n er el l a f o r sy t h i a.
Per iodont ol 2000. 2010; 54: 106- 16.
26- Signat B, Roques C, Poulet P, Duffaut D. Fusobact er ium nucleat um
in periodont al healt h and disease. Curr I ssues Mol Biol. 2011; 13: 25- 36.
6RFUDQVN\66+DIIDMHH$'&XJLQL0$6PLWK&.HQW5/-U0LFURELDO
com plexes in subgingival plaque. J Clin Per iodont ol. 1998; 25: 134- 44.
28- Ter vonen T, Oliver RC, Wolff LF, Ber eut er J, Ander son L, Aeppli DM.
Pr evalence of per iodont al pat hogens w it h var y ing m et abolic cont r ol of
diabet es m ellit us. J Clin Per iodont ol. 1994; 21: 375- 9.
29- Yuan K, Chang CJ, Hsu PC, Sun HS, Tseng CC, Wang JR. Det ect ion
of put at ive per iodont al pat hogens in non- insulin- dependent diabet es
m ellit us and non- diabet es m ellit us by poly m erase chain r eact ion. J
Per iodont al Res. 2001; 36: 18- 24.
3 0 - Z h ou M, Ron g R, Mu n r o D, Z h u C, Gao X, Z h an g Q, et al.
I nvest igat ion of t he effect of t y pe 2 diabet es m ellit us on subgingival
plaque m icrobiot a by high- t hroughput 16S rDNA pyrosequencing. PLoS
