[PDF] Top 20 Use of real-time PCR to evaluate two DNA extraction methods from food
Has 10000 "Use of real-time PCR to evaluate two DNA extraction methods from food" found on our website. Below are the top 20 most common "Use of real-time PCR to evaluate two DNA extraction methods from food".
Use of real-time PCR to evaluate two DNA extraction methods from food
... values of A 260 /A 230 showed no difference between the extraction methods of TSP and soy milk, providing a good DNA ...regard to the infant formula, the CTAB method gave a ... See full document
7
Comparison of real-time PCR and conventional PCR for detection of
... past two decades, cnPCR technique has been modified to expand its use and versatility ...possibility of using it in the same reaction, on a pair of primers with simultaneous ... See full document
6
International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients
... Solvent extraction kDNA 121-122 Conventional In-House 40 LbN/2 Solvent extraction Sat-DNA Tcz1-Tcz2 Conventional In-House 35 LbO Solvent extraction kDNA 121-122 Conventional In-House 40 LbP/1 ... See full document
13
Quantitative real-time PCR for the clinical detection of Helicobacter pylori
... diagnosis of Helicobacter pylori infection is very important in both clinical practice and ...sensitivity of real-time PCR (RT-PCR) for the detection and quantification of ... See full document
4
Applicability of the real-time PCR assay in the amplification of cyanobacterial DNA from preserved samples
... monitoring of cyanobacterial blooms often involves the use of preserved samples to avoid cellular ...preservation methods can interfere with DNA quality/quantity. ... See full document
14
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
... easy to use. Thus, the PCR-based detection of bacteria depends on the efficiency of DNA extraction procedure used to prepare the template ...strain of ... See full document
9
Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR
... used to analyse ccf nDNA and ccf mtDNA simultaneously. Using the optimised PCR protocol, the amplification of nDNA and mtDNA in a single reaction tube was very simi- lar and showed a simulation ... See full document
5
Evaluation of methods for the extraction and purification of DNA from the human microbiome.
... the DNA yield through use of physical disruption methods such as bead beating and sonication to improve the lysis of bacterial ...genomic DNA into small fragments and this ... See full document
10
A real-time PCR antibiogram for drug-resistant sepsis.
... testing of septicemia rely on genotyping for the presence of known resistance ...due to the inability to detect newly emergent resistance ...method to assay for resistance; however, ... See full document
6
Comparative study of two extraction methods for enteric virus recovery from sewage sludge by molecular methods
... Non-kit-based methods are preferred for routine laboratory procedures all over the world because they are less expensive than kit-based ...solution of phenol and guanidine isothiocyanate that is preferred ... See full document
4
Comparative analysis of conventional PCR and real-time PCR to diagnose shrimp WSD
... and two steps (Nested) WSD PCR. The different qPCR methods were performed using the primer set WSS1011F (5’ TGGTCCCGTCCTCATCTCAG 3’) / WSS1079R (5’GCTGCCTTGCCGGAAATTA 3’) and probe (5’ ... See full document
4
Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR
... countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA ... See full document
6
Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.
... specificity of the traditional and direct rt-PCR methods, CSF from meningitis patients were obtained from the following countries as part of their routine surveillance ... See full document
7
Comparison of Different Methodologies for DNA Extraction from Aegla longirostri
... extraction from Aegla’s hepatopancreas provided a small amount of material, hence this tissue can be discarded from the DNA extraction ...relation to the conservation ... See full document
6
Evaluation of methods for taxonomic relation extraction from text
... possibility of identifying hypernyms using a directional simi- larity measure (InvCL ...inclusion of the features of u in v, but also the non-inclusion of the features v in ...extracted ... See full document
151
METHODS TO EVALUATE THE EGGSHELL QUALITY OF TABLE EGGS
... EBS of horizontally- positioned eggs, the highest coefficient of correlation was obtained with shell weight per unit surface ...coefficient of correlation was with egg specific gravity, followed by ... See full document
6
Verifying Real-Time Systems using Explicit-time Description Methods
... Description Methods which aim to use ordinary model checkers to realize timed model ...(Tick) to simulate the passage of time and a pair of global variables ... See full document
12
Construction of DNA hemicatenanes from two small circular DNA molecules.
... precisely to what was expected for two hemicatenated circles, whether samples are analyzed as native material (left half of the gel) or denatured by al- kali (right ...leads to dissocia- tion ... See full document
16
To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis)
... method of physical disruption of the hard, chitinous exoskeleton of ticks prior to DNA extraction, we compared cross-sectionally dividing ticks (bisection for nymphs and ... See full document
14
Detection of Campylobacter spp. in chilled and frozen broiler carcasses comparing immunoassay, PCR and real time PCR methods
... 100mL of Bolton broth with a selective supplement (SR183E, Oxoid, Basingstoke, UK) and was subjected to a washing process by rinse friction for approximately 1min (bioMérieux, ...aliquots of the ... See full document
7
temas relacionados